Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 6 CHLORO 1 METHYL 5 INDOLECARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 1% non-essential amino acids and 1% sodium pyruvate (Gibco), and grown at 37°C and 5% CO2 as described previously (Hoffmann et al 2020) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% nonessential amino acids and 1% penicillin/streptomycin (Life Technologies). Human embryonic kidney (HEK293T ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Microbiology 2023Quote: ... Protein-nucleic acid mixtures were then loaded into either 6% or 10% Novex TBE gels (Thermo Fisher). Gels were pre-run for at least 30 min at 100V in 0.5x TBE buffer before sample loading ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were dislodged with PBS containing 5 mM ethylenediaminetetraacetic acid (EDTA; Life Technologies) (PBS-EDTA ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 to 50 μl of cell lysate was digested using a 5:1 mixture of nitric acid (OPTIMA grade, 70%, Fisher Scientific) and ultrapure hydrogen peroxide (ULTREX II ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA migration was detected by a 5 min incubation with SYBR Gold Nucleic Acid Gel Stain (Invitrogen #S11494, 1/10, 000) and revealed using a Chemidoc MP Immaging System (BIO-RAD) ...
-
bioRxiv - Microbiology 2023Quote: ... The dry pooled sample was resuspended in 1 ml of 5% formic acid and was desalted using the EasyPep Maxi Kit (Thermo Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 1 × TE buffer (5 mM Tris base, pH 8.0 and 1 mM EDTA acid) containing 15% w/v PEG-8000 (Fisher Scientific, BP2331) and 510 mM NaCl was added to the SQB sample at 1:1 volume and mixed gently via pipetting ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Biophysics 2021Quote: ... The nucleic acid-specific fluorochrome SYTO 13 green fluorescent nucleic acid stain in 5 mM solution in DMSO (Molecular Probes, Eugene, OR) was used in all experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... A 1 ml aliquot was treated with 2 μM tetramethylrhodamine methyl ester perchlorate (TMRE) (Molecular Probes, USA) and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA plus PIC) with 20 mM thiol-reactive methyl-methane thiosulfonate (MMTS, Thermo Fisher Scientific) to block free cysteine residues ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2) adding 25 μL of N-methyl-N-trimethylsilyltriAuoroacetamide (TMS) with 1% trimethylchlorosilane (Thermo Fisher Scientific) and incubated for 30 minutes at 60°C ...
-
bioRxiv - Bioengineering 2020Quote: ... methyl ester (TMRM) (0.1µM in hepatocyte medium, Thermo Fisher) to visualize active mitochondria ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Bioengineering 2022Quote: ... mitochondrial membrane potential (tetramethylrhodamine methyl ester, TMRM; ThermoFisher Scientific) and mitochondrial superoxide (MitoSOX Red ...
-
bioRxiv - Genomics 2022Quote: ... Histone H3 Lysine 4 tri-methyl (ThermoFisher PA5-27029), Histone H3 Lysine 27 acetylation (Abcam ab4729) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... 12.5 mM methyl-α-d-mannopyranoside (Thermo Fisher Scientific), 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were stained with tetramethylrhodamine methyl ester (TMRM) (Invitrogen) at a non-quenching concentration (20nM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... methylparaben (Methyl 4-hydroxybenzoate, MP; Acros Organics, CAT: 126961000), and butylparaben (Butyl 4-hydroxybenzoate ...
-
bioRxiv - Genetics 2023Quote: ... and Tetramethylrhodamine methyl ester (TMRM, 0.1µM, Thermo Fisher I34361) for 30 minutes at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... and tetramethylrhodamine methyl ester perchlorate (TMRE) (ThermoFisher, Waltham, MA) dyes ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Genetics 2022Quote: ... ~1 × 105 hTSC were seeded onto 6 well plates coated with either 5–10 μg/mL collagen IV (10376931, Fisher Scientific) or 0.5 μg/mL iMatrix 511 (NP892-011 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Genetics 2023Quote: ... Cultures were passaged every 5-6 days as small clumps by dissociation with a buffer containing 1 mg per ml Collagenase IV (ThermoFisher Scientific), 0.025% Trypsin (ThermoFisher Scientific) ...
-
bioRxiv - Biophysics 2023Quote: ... 400 μg of calmodulin and myosin-5 expression vectors (at a 1:6 ratio) were mixed with 15 ml FreeStyle 293 media (Thermo Fisher) and 1.2 ml of PEI (Polysciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.7 mL Buffer 2 (1 M sorbitol, 50 mM MES, pH 6, 5 mM MgCl2) plus protease inhibitors (Thermo Scientific A32955) was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... with a 6-FAM™ fluorescent tag at its 5’ end (Life Technologies). Three primers PCR amplification were performed using the Qiagen Multiplex PCR kit (206143 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Cells were grown for 5–6 days in IMDM (Thermo Fisher Scientific, 12440053) supplemented with 1% non-essential amino acids (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Cell Biology 2019Quote: ... BODIPY-493/503 Methyl Bromide (used at 1/1000 from 1 mg/ml ethanol stock) and CellTracker green (C2925) from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 x non-essential amino acids (Thermofisher; #11140050), 1 x penicillin/streptomycin (Thermofisher ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% non-essential amino acids (Thermo Fisher Scientific), 0.1 mM [β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 × non-essential amino acid solution (Invitrogen, USA), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM non-essential amino acids (Life Technologies) and 2 mM glutamine (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM non-essential amino acids (Life Technologies) and 2 mM glutamine (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1% Non-Essential Amino Acids (Gibco, 11140076). For transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 x non-essential amino acids (Thermofisher Scientific) and 1x penicillin-streptomycin (Thermofisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1%(v/v) non-essential amino acids (Gibco), 1x penicillin/streptomycin (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1%(v/v) non-essential amino acids (Gibco), 1x penicillin/streptomycin (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... 1 % Non-Essential Amino Acids (11140050, Life Technologies), 1% PenStrep (15240-062 ...