Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 6 4 METHOXY PHENYL 3 METHYL IMIDAZO 2 1 B THIAZOLE 5 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µL of 1 mg/mL DAPI (4′,6-diamidino-2-phenylindole; ThermoFisher Scientific) was added to each sample and incubated at RT in darkness for a further 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FCS and 2% B-27 (Gibco) and maintained at 5% CO2 and 37°C in humidified incubators ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Developmental Biology 2024Quote: ... with the first wash including 5 µg/ml DAPI (4′,6-diamidino-2-phenylindole; ThermoFisher Scientific) to stain nuclei ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher Scientific) was applied to samples at a concentration of 0.1μg/ml ...
-
bioRxiv - Bioengineering 2022Quote: ... DAPI (4’ −6’ -diamino-2-phenylindole, dilactate; Invitrogen) was used for nuclear staining ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) was added for 30 min at room temperature before the secondary antibodies were washed out in PBS 3x for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, D3571) was added for 5 minutes in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4-6-diamindino-2-phenylindole; Molecular Probes) was used to detect DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000, Invitrogen) for 3 min and eventually coverslips were mounted with Dako mounting kit (Fluka) ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10 000, Invitrogen).
-
bioRxiv - Neuroscience 2021Quote: ... and 1:500 dilution of DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (ThermoFisher). The brain slices were washed 3x with 1XPBS and then mounted with mounting media (Fluoro-Gel ...
-
bioRxiv - Immunology 2020Quote: ... and stained for DAPI (4′,6-diamidino-2-phenylindole) (Life Technologies, 1:1000). For each condition ...
-
bioRxiv - Cell Biology 2021Quote: ... coverslips were stained with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, 1:10,000) in 1X PBS for 5 min.
-
bioRxiv - Cell Biology 2024Quote: ... and stained with 4’,6-diamdino-2-phenylindole (DAPI) (1:500, ThermoFisher, 62248) in 1X DPBS for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... sections were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) and mounted with glycerol-gelatin aqueous slide mounting medium (Sigma Aldrich) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was visualized using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... and Methyl-(PEG)4-NHS (Life technologies) in 1 x PBS were introduced and incubated for 1 h [25] ...
-
bioRxiv - Biophysics 2024Quote: ... and methyl-(PEG)4-NHS (Life technologies) in 1 x PBS were introduced and incubated for 1 h [120] ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Genomics 2019Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) at a final concentration of 3 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...