Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... Round 2 and 3 PCRs were followed in real time using SYBR Green (Invitrogen) and stopped prior to plateauing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged every 2-3 days by washing with HBSS (Gibco, cat#14170), trypsinizing using 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MMT) was obtained from Thermo Fisher. Crystal violet was purchased from VWR ...
-
bioRxiv - Bioengineering 2020Quote: Nbs were diluted in a 2- or 3-fold series in Opti-MEM (Thermofisher). Each Nb dilution (110 μl ...
-
bioRxiv - Physiology 2021Quote: ... cells were fed every 2-3 days with DMEM + 10% FBS (Thermo fisher Scientific) until differentiation was complete at day 10.
-
bioRxiv - Immunology 2022Quote: ... The band are visualized with gel electrophoresis using 2-3% agarose (#16500500, Thermo Fisher) gel with SYBR Safe dye (#S33102 ...
-
bioRxiv - Genomics 2019Quote: ... Round 2 and 3 PCRs were followed in real time using SYBR Green (Invitrogen) and stopped prior to plateauing ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2-3 sections were mounted on each Superfrost Plus slide (Thermo Fisher Scientific). All sections were air-dried at −20 ° C for 1 hour and afterwards stored at −80 ° C.
-
bioRxiv - Genomics 2023Quote: ... use 10 μL for 2-3 ml of blood) or EDTA (0.5M EDTA, Gibco, cat ...
-
bioRxiv - Cell Biology 2023Quote: ... MCEC were split every 2-3 days using TrypLE express enzyme (GibcoTM, Thermo Scientific) for 5min at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... and 2 µl of DNA using QuantStudioTM 3 real-time PCR system (ThermoFisher Scientific). For the amplification of GLS promoter region upstream of the repeat ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin/EDTA (Gibco™, 25300062). Cell density was 5x 104 per well for the experiments in the μ-Slide (ibidi ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies were removed by 3 washes with 2% BSA 1x PBS and incubated with 2 μg/ml anti-rabbit IgG Alexa Fluor 594 (Thermo Fisher) for 2 h in the dark at 4°C ...
-
bioRxiv - Physiology 2023Quote: ... The final plasmids for the sense and antisense expression of daf-2 or aak-2 under the str-3 promoter were generated using Gateway Cloning Technology (Life Technologies) and injected into FLP-7 secretion line (SSR1164 ...
-
bioRxiv - Immunology 2020Quote: Macrophages were incubated with the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (10 μM, Invitrogen, California, USA) in PBS for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... containing 2’-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 50 μM; Thermo Fisher Scientific). To determine FA uptake ...
-
bioRxiv - Immunology 2023Quote: ... stained with Ghost-510 and 2-(N-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose (2-NBDG; 60 µM) (Thermo Fisher Scientific) (30 min at 37 C) ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of peptides in a volume of 1-4 μL was loaded onto the Acclaim μ-Precolumn (0.5 mm х 3 mm, 5 μm particle size, Thermo Scientific) at a flow rate of 10 μL/min for 4 min in an isocratic mode of Mobile Phase C (2% MeCN ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... The fluorogenic probe 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (abbr. CPM, ThermoFisher, Cat# D346) in 100% DMSO was then added to both quench the enzymatic reaction and react with CoASH to yield the fluorescent CPM-SCoA complex for fluorescence quantification 27 ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Immunology 2020Quote: ... 25mM HEPES (2(−4-(2-hydroxyethyl)-1-piperanzinyl) ethansulfonacid) and supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, ThermoFisher Scientific), 10.000 U/mL (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... were mixed in a 3:1 with sample buffer (NuPAGE™ LDS Sample Buffer (4X) + 2-Mercaptoethanol in 2:1) and loaded onto a precast Gel (NuPAGE™ 4-12% Bis-Tris Gel, Invitrogen). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...