Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The surface of the master was treated with 1H,1H,2H,2H-perfluo-rooctyltrichlorosilane (Thermo Scientific) to promote the removal of elastomer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 µl of Novec 7500 containing 20 % 1H,1H,2H,2H-perfluorooctanol (PFO; ThermoFisher Scientific GmBH, Germany) was added to the suspension and mixed by pipetting resulting in bead clustering ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Neuroscience 2023Quote: ... 10% Donkey Serum, 1% Triton-100, 1h) followed by primary (overnight, 4°C) and secondary antibodies (1-2h, Jackson ImmunoResearch or ThermoFisher Scientific) incubation ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunolabeling with performed with mouse anti-B23 primary antibody (1:300; 2h) then detected with Alexa 488 donkey anti-mouse antibody (Invitrogen; 1:500; 1h), then further fixed with 4% paraformaldehyde in DEPC-PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... for 2h at RT followed by a 1h incubation with 1:200 secondary goat anti-rabbit antibody Alexa 647 (Thermo Fisher, A32733) and DAPI to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Immunology 2022Quote: ... membranes were washed three times with PBS-T and then incubated with appropriate secondary antibody conjugated with alkaline phosphatase that provides a visual color change upon addition of the chromogenic substrate (mixture of BCIP (5-bromo-4chloro-3-indolyl phosphate-catalog# 34040) and NBT (nitro-blue tetrazolium chloride, catalog# 34035 from Thermo Scientific)).
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein– antibody complexes were visualized using the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium for color development (Life Technologies).
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Plant Biology 2024Quote: ... Neutral lipids accumulation was estimated after staining with Nile Red (9-diethylamino-5- benzo[a]- phenoxazinone, Thermofisher) for 20 minuts at a final concentration of 0.5 mg.mL-1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Developmental Biology 2024Quote: ... 5-ethynyl-2-de-oxyuridine (EdU; ThermoFisher) was provided via intracardiac intravenous injection for chick embryos (E4 ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.30 M di-benzo-18-crown-6-ether (Thermo Scientific) following published protocols66,67,79,80,110 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Microbiology 2024Quote: ... for 1h at 37°C and then with 3 µM DAPI (Invitrogen) for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Neuroscience 2023Quote: ... A-21449 RRID:AB_2535866) (1:500, 2h incubation; Invitrogen, Canada). Slices were mounted on charged microscope slides (Superfrost/Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... RRID: AB_10541045) for 3 days at 4°C followed by 2h in 1:800 anti-mouse FluoroNanogold (Life Technologies, A24920) at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... then blocked for 1h at RT in 5% NBCS (Gibco, #16010-159), antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Physiology 2023Quote: ... and then 2h in Streptavidin 647 (1:400, Molecular Probes). This was followed by placing in 5% normal goat serum for 1h and labelling for mCherry with rabbit anti-mCherry (1:10,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked for 1h at RT in blocking solution (5% rabbit serum (10510, ThermoFisher) and 1% BSA (A4503 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... phalloidin Texas red (1:100, 1h, Life technologies #T7471) and anti-alpha-Tubulin-FITC (1:200 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Physiology 2020Quote: ... Slides were rinsed in PBS 3×5min and then incubated for 1h at room temperature in goat anti-rabbit AF647 (1/250, 21245, Life Technologies) or donkey anti-goat AF647 (1/500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...