Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 5 Methyl 3 phenylmethylene 2 3H furanone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Molecular Biology 2019Quote: ... the PCR products obtained with 2 primers (AV48_SMCHD1_gPCR_F: 5’-AGGAGCGCGTTTGAATCGG-3’, AV47_SMCHD1_gPCR_R 5’-CTTCGCGTACCTGACACACAC-3’) were TOPO-cloned (Thermo Fisher, #450071) and sent for sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM methyl-β-cyclodextrin (Acros Organics, NJ) (mβCD ...
-
bioRxiv - Molecular Biology 2019Quote: ... miR-125b+A or control RNA 3’O-methyl-modified mimic using 5 μl Lipofectamine 2000 (Life Technologies) in a 500 μl reaction mixture according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the spots corresponding to [3H]GDP and [3H]ppGpp were cut out and quantified by scintillation in 5 ml of ScintiSafe scintillation cocktail (Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Bioengineering 2019Quote: ... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco, MA]/44 mM sodium bicarbonate [Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2019Quote: The 2′ O-methyl phosphorothioate AOs were transfected into dermal fibroblasts as lipoplexes using 3 μl of Lipofectamine 3000 (Life Technologies, Melbourne, Australia) per 1 ml of OptiMEM ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) at 30 °C for 45 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...