Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 5 Fluoro 2 piperidin 2 yl 1H benzimidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... cells at 2×107 /mL with CTV at 5 μg/mL (Thermo Fisher) and incubating for 15 min at 37 °C followed by blocking in FBS and washing with complete medium according to the aforementioned protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in 1x PBS at 5 mg/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were intraperitoneally injected with 5-ethynyl-2’-deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Cell Biology 2023Quote: Whole 5-day-old seedlings were incubated with 2 µM FM4-64 (Invitrogen) solution in half-strength MS liquid medium without sucrose at room temperature for 15 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (Thermo Fisher) for 30 min and alkylated with 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μg of antibody coupled to 2 μg of magnetic Dynabeads (Life Technologies) was added to 3 mL of sonicated nuclear extract from formaldehyde-fixed cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Microbiology 2023Quote: Mice were injected with 100 μg of 5-ethynyl-2’deoxyuridine (EdU, Invitrogen) 2 hours prior to splenocyte harvest ...
-
bioRxiv - Molecular Biology 2023Quote: ... HelaS3 cells were treated with 10 µM 5-ethynyl 2’-deoxyuridine (EdU) (Invitrogen) for 15 min to visualize replicated DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... organoids were treated with 10 μM 5-ethynyl-2’-deoxyuridine EdU (#E10187, Invitrogen) 24 hours prior to harvest ...
-
bioRxiv - Immunology 2023Quote: Mice received 500 µg of 5-ethynyl 2’-deoxyuridine (EdU) (Thermo Fisher A10044) in a 100 µl PBS intraperitoneal injection at 24 hours and 4 hours prior to sacrifice ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were pulsed with 1 mM 5-Ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 3 hr ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 μL of 200mg/ml 5-ethynyl-2’-deoxyuridine (EdU; E10187, ThermoFisher Scientific) was administered daily for 2 weeks by intra perennial injections into 4 week ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, 0.5 mg/ml in PBS; Thermo Fisher Scientific) was administered by intraperitoneal injection at 0.1 mg per 20 g body weight per injection ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Proteins were reduced with 5 mM tris (2-carboxyethyl) phosphine (Thermo Fisher Scientific) at 90 °C for 15 min and alkylated using 10 mM iodoacetamid (Sigma Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... were co-transfected with the EGFP-Caspase 2 or EGFP-Δ Caspase 2 plasmid and the synthesized miR-2 (miR-2-mimic) using Cellfectin II transfection reagent (Invitrogen) according to the manufacturer’s protocol ...
-
A Polybasic Domain in aPKC Mediates Par6-Dependent Control of Membrane Targeting and Kinase ActivitybioRxiv - Cell Biology 2020Quote: ... cells were imaged in Fluoro-Brite medium (Life Technologies) using a Nikon A1R confocal laser scanning microscope though a 100x ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl of 100 μM oligonucleotide bridge 2 and 2 units of T4 PNK (ThermoFisher) were added to 20 μl of the purified smDNA solution ...
-
bioRxiv - Cancer Biology 2019Quote: ... human recombinant IL-2 (2 ng/ml) (Gibco, USA), IL-7 (10 ng/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 2 washes of 2× SSC (Ambion AM9765) for 5min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 mM GlutaMax supplemented with 2% B27 (Gibco) and 5% horse serum (Hyclone) ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 0.05 mM 2-mercaptoethanol (2-ME; Gibco). Mouse melanoma cell line B16 (ATCC ...
-
bioRxiv - Bioengineering 2023Quote: ... and recombinant human interleukin-2 (IL-2) protein (Invitrogen) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
bioRxiv - Biophysics 2021Quote: ... we labeled 5-30 μM protein with 2 mM DTNB (Ellman’s reagent, Thermo Scientific) in 20 mM Tris ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA (2-5 µg) was treated with DNAse I (Thermo Fisher Scientific, Cat # AM1906) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were incubated with 10 µM 5-ethynyl-2’ deoxyuridine (EdU, Thermo Fisher) for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Slides were then blocked with 2% BSA and 5% donkey serum (ThermoFisher Cat # NC9624464) in PBS for 1 hour ...
-
bioRxiv - Developmental Biology 2021Quote: Click-iT EdU (5-ethynyl-2’-deoxyuridine, a thymidine analog) kit from Life Technologies was used to perform DNA replication assay (Milton et al. ...
-
bioRxiv - Genomics 2020Quote: ... 5 µl of 10X Turbo DNase buffer and 2 µl Turbo DNase (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... The samples were then reduced with 5 mM Tris(2-carboxyethyl)phosphine (ThermoFisher Scientific) for 30 minutes at 37 °C and then alkylated in the dark for 30 minutes at 25 °C with 40 mM iodoacetamide (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2019Quote: ... Grids were blotted for 2–5 s in a Vitrobot (Mark IV, Thermo Fisher) at 10–15 °C and 100% humidity ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μl of purified products were loaded on 2% E-Gel EX (Invitrogen) to verify the reaction performance and amplicon size ...
-
bioRxiv - Neuroscience 2021Quote: ... and two injections of 5-ethynyl-2’-deoxyuridine (EdU: 0.01 mg/kg, Invitrogen #A10044), made as a 10 mM stock solution in DMSO and diluted for injection to 40% strength in 0.9% sterile saline ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Molecular Biology 2022Quote: ... and were supplemented with 10mM EdU (5-ethyl-2’-deoxyuridine) (ThermoFisher Scientific, Rockford, IL) during the final 6 hours of incubation to mark proliferating cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... mixed with 5 μl of 2 x Novex TBE-Urea sample buffer (ThermoFisher Scientific) and denatured for 3 minutes at 70°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... For labeling of proliferating cell populations with 5-ethynyl-2’-deoxyuridine (EdU) (ThermoFisher Scientific), animals received IP injections of EdU (50 mg/kg ...
-
bioRxiv - Biophysics 2022Quote: ... 5 μM Fluo-2 Low Affinity (TefLabs) and 2.5 μM Alexa568 (Invitrogen, Waltham MA) as previously described (36) ...
-
bioRxiv - Neuroscience 2022Quote: ... passed through Xylol (2 x 5 minutes) and immediately mounted with Eukitt® (ThermoFisher).
-
bioRxiv - Developmental Biology 2020Quote: ... viride were incubated in 100 μM 5-ethynyl-2’-deoxyuridine (EdU; Thermo Fisher Scientific) diluted in ASW from 24 to 48 HPA ...
-
bioRxiv - Microbiology 2021Quote: ... All medium were supplemented with 2-5 or 10% fetal bovine serum (FBS; Gibco) according to the experimental setting ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... a ClickiT ® EdU (5-ethynl-2’-deoxyuridine) cell proliferation assay (Invitrogen, Paisley, UK) was used ...