Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... 24 μg plasmids and 24 μL FectoPro transfection reagent were mixed in 3 mL Opti-MEM medium (ThermoFisher), then incubated for 20 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... slides were incubated for 24 minutes in a mixture of 3% 3-Aminopropyltriethoxysilane (ACROS Organics, 430941000) and 5% acetic acid in HPLC EtOH ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated for 24 min in a mixture of 3% 3-aminopropyltriethoxysilane (ACROS Organics, 430941000) and 5% acetic acid in HPLC ethanol ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific, 22980) were added to the alginate solution in a molar ratio of 1 alginate:30 NHS:25 EDC ...
-
bioRxiv - Immunology 2022Quote: 22-(N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Amino)-23,24-Bisnor-5-Cholen-3β-Ol-cholesterol (22-NBD-cholesterol) (N1148) and 7-NBD-PE (N360) were obtained from Thermo Fisher and dissolved in ethanol at 1 mM ...
-
bioRxiv - Microbiology 2020Quote: ... 24 mL 5% NaHCO3 (Gibco) and 340 ml water ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 24 hours post-plating cells, TMRE (tetramethylrhodamine, ethyl ester) (Thermo Fisher Scientific, # T669) was added to the medium (50nM ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL of ion-pairing agent (0.1% o-toluidine blue, Carolina Biological) and 3 µL of ethyl acetate (ACS grade, Fisher Scientific). The mixture was vortexed and centrifuged briefly ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Developmental Biology 2023Quote: ... R 5’-atggatccTCATAGAGCTGAAGCCACCAG-3’) were generated by PCR amplification from 24 hpf whole embryo cDNA and cloned to pCRII-TOPO (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... differentiated OLs at 6 DIV (‘OL 3 days’) were transfected with plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... or si-hsa-CHST15_0003 (n□=□3) or si-hsa-TNFRSF21_0001 (n□=□3) for 24□hours was carried out by using human Clariom™ Sassay (ThermoFisher Scientific) at the Bioinformatics and Expression Analysis (BEA ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2021Quote: ... (Cai et al., 2009), or Kif15 (5’-GGACAUAAAUUGCAAAUAC-3’, 24 h) (Vanneste et al., 2009) using Lipofectamine RNAiMAX (13778075, Thermo Fisher) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Biophysics 2024Quote: ... and 250 µM of EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Thermo Scientific, 24510) in Borate buffer (100 mM Borate-NaOH ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 and 24 hours later the plating medium was exchanged against NeurobasalTM containing 2% BL27 (Gibco) and 0,8 mM L-glutamine (all Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3) Oxidative stress induction using 70 μM tert-Butyl hydroperoxide (Thermo Fisher 180345000) for 16-18 h ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2024Quote: ... EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) and Sulfo-NHS (N-hydroxysulfosuccinimide) were purchased from ThermoFisher (USA). Unless otherwise stated all other chemicals were received from Sigma (St Louis ...
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
bioRxiv - Plant Biology 2022Quote: The stock solutions for the GLVs (Z)-3-hexen-1-ol (Z3-HOL, 98%; Acros Organics) and (Z)-3-hexenyl acetate (Z3-HAC ...
-
bioRxiv - Cell Biology 2023Quote: ... After 24 h the cells were washed 3 times with prewarmed Hank’s Balanced Salt Solution (HBSS, Thermo Fisher) and stained with 1 μM of Bodipy red ER-tracker™ (Thermo Fisher E34250) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...