Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 3 Iodo 2 6 dimethyl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Probenecid (4-(dipropylsulfamoyl)benzoic acid) (water soluble form, ThermoFisher Scientific, P36400) was used at 1mM (after calibrating the effect between 250 µM and 1 mM).
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Immunology 2024Quote: 50 000 enriched CD11b+ LCs were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: All fly lines were maintained in mixed sex groups in bottles on JazzMix media or our own food made following the same recipe (brown sugar, corn meal, yeast, agar, benzoic acid, methyl paraben and propionic acid; Fisher Scientific, Whitby, ON, Canada) at 25°C ...
-
bioRxiv - Immunology 2021Quote: ... Uptake of fatty acids was quantified after incubation with 1uM 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic acid (Bodipy-FL C16, Thermo Fisher) at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: BODIPY FL C16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Invitrogen D3821) was used to assess the ability of 3T3s to transport fatty acids into the cell from their surroundings ...
-
bioRxiv - Cell Biology 2024Quote: BODIPY-FL-C16 (C16) (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid (ThermoFisher, #D3821) or BODIPY 558/568 C12 (C12 ...
-
bioRxiv - Microbiology 2020Quote: ... or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16, Thermo Fisher Scientific) in a modified SC medium ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Biophysics 2024Quote: ... USA) dissolved in ethanol or 1μL 2.5mg/mL N,N-Dimethyl-6-dodecanoyl-2-naphthylamine (LAURDAN; Thermo Fisher, USA) dissolved in dimethyl sulfoxide to label the EVs ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... cells were stained by BODIPY™ FL C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific #D3922) to determine the amount of lipid droplet in regular conditions ...
-
bioRxiv - Genetics 2020Quote: ... 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene 3-dodecanoic acid (BODIPY™ FL C12; Thermo Fisher Scientific, USA) (4 µg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... P8 pups were fed 1 μl 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid BODIPY™ FL C16 (BODIPY FL C16, ThermoFisher Scientific, D3821) diluted in olive oil at a concentration of 10 μg/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Neuroscience 2020Quote: ... A Iodo-Gen® coated tube (Thermo Scientific, Merelbeke, Belgium) was first of all rinsed with 1 mL of phosphate buffer ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Neuroscience 2021Quote: ... 10% dimethyl sulfoxide and 2% (w/v) Pluronic F-127 (Invitrogen) in Ca2+/Mg2+ free pipette solution (in mM ...
-
bioRxiv - Bioengineering 2024Quote: ... 6-trifulfonic acid (ANTS; Thermo Fisher Scientific), 0.2 M 2-picoline borane (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Neuroscience 2024Quote: After a wash in Carnoy’s solution (6 ethanol: 3 chloroform: 1 acetic acid; all from Thermo Fisher, USA), used to removed most of the lipids from the section [45] ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with 3 mM dimethyl 3,3′-dithiobispropioimidate (DTBP; Thermo Fisher Scientific, #20665) for 5 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cancer Biology 2024Quote: ... TRACER rolls and unrolled control samples were incubated at 37 °C in complete organoid media with 50 μM of 5-Iodo-2’deoxyuridine (IdU, Fisher Scientific) and 20 uM of Telox64 (courtesy of Mark Nitz ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Cell Biology 2024Quote: Sodium salt of 3-methyl-2-oxobutanoic acid (KIV; cat # AC189720050) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Bioengineering 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Cas. No. 28718-90-3, Thermo Scientific GmbH, Germany), Tween 20 (Art ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2024Quote: ... and valproic acid (3 mM, Acros Organics). The DNA/FectoPro amount was scaled proportionally depending on the size of the transfection ...