Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 3 3 Dimethyl 6 oxa 3 phosphoniabicyclo 3.1.0 hexane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with 3 mM dimethyl 3,3′-dithiobispropioimidate (DTBP; Thermo Fisher Scientific, #20665) for 5 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2024Quote: Two million splenocytes in 200 μl PBS from WT-Foxp3YFPCre/YFPCre and Dgka-/-zf/f-Foxp3YFPCre/YFPCre mice were seeded into a U-bottom 96-well plate in the presence or absence of 100 μM 2-(N-(7-Nitrobenz-2-oxa-1, 3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; Life Technologies). After incubation at 37°C with 5% CO2 for 30min ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted and quantified from WwoxWT/WT and WwoxP47T/P47T n=6 mice/group (3 males and 3 females) and cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... TOPRO-3 (Invitrogen) was added to the staining buffer at a dilution of 1:10000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...