Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 3' 3' Cyclic GAMP cGAMP ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... 96-well PCR plates were read using a Quantstudio 3 System (ThermoFisher Scientific) and results were analyzed using the delta-delta CT method ...
-
bioRxiv - Neuroscience 2020Quote: ... coli were spread onto the plate using 3 mm glass beads (Fisher Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells (3 x 105) were seeded on coverslips in 48-well plates (Nunc), allowed to attach overnight ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed 3 times and 0.1ng/ml SA-alkaline phosphatase (ThermoFisher; 21324) in 0.1% BSA in PBS was incubated for 45 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 288 individual clones (3 x 96w plates) were selected using Collagenase (ThermoFisher Scientific) dissociation and manual selection under a microscope ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell density of each plate was determined using a Countess 3 (Thermofisher). The supernatant was discarded ...
-
bioRxiv - Immunology 2021Quote: ... polystyrene Micro-ELISA plates (Nunc, Copenhagen, Denmark) were coated overnight with 100 μl per well of antigens at a concentration of 10 μg/ml and 5μg/ml for SLA and malaria crude antigen respectively in PBS pH 9.6 ...
-
bioRxiv - Immunology 2021Quote: ELISA 96-well plates (Thermo Scientific, 442404) were coated with 0.5 µg/mL whole virus H1N1pdm09 (NYMC-X181 ...
-
bioRxiv - Developmental Biology 2019Quote: ... we used 96-wells ELISA plate (Thermofisher) and assays were performed in a total volume of 50 µL of acetyltransferase buffer (50 mM Tris pH8 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with goat anti-mouse IgA (Southern Biotech #1040-01 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with the cecal lysate (100 μL/well ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with αGal-BSA (Dextra ...
-
bioRxiv - Immunology 2021Quote: ... 96 well maxisorp ELISA plates (Thermo fisher) were coated with 2 μg N protein ...
-
bioRxiv - Biochemistry 2021Quote: ... ELISA microtiter plates (Nunc, MaxiSorp, Roeskilde, Denmark) were coated overnight in 4°C with conjugates (2 μg/well ...
-
bioRxiv - Microbiology 2020Quote: Immulon 4HBX 96-well ELISA plates (ThermoFisher) were coated overnight at 4 °C with 200ng/well of ZIKV virus particles diluted in PBS (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... white MaxiSorp ELISA plates (Thermo Fisher Scientific) were incubated with 5 μg/ml of antibodies or 1:500 diluted plasma in 100 μl phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Flat bottom 96-well ELISA plates (Nunc MaxiSorp Plates ...
-
bioRxiv - Immunology 2022Quote: ... High-binding 96-well ELISA plates (Nunc) were coated with anti-mouse IL-10 (eBioscience ...
-
bioRxiv - Microbiology 2020Quote: High-binding 96-well ELISA plates (Nunc) were coated with 0.5 µg/well of purified SARS-CoV-2 N protein in carbonate/bicarbonate buffer 0.05 M pH 9.6 and allowed to bind over night at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... Immunolon 4HBX ELISA plates (Thermo Fisher Scientific) were coated with capture antibody at 4° overnight ...
-
bioRxiv - Immunology 2020Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with purified IgG (5 µg/mL in Carbonate-Bicarbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with purified IgG (5 µg/mL in Carbonate-Bicarbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with purified IgG (5 µg/mL in Carbonate-Bicarbonate buffer ...
-
bioRxiv - Immunology 2020Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with either αGal-BSA (Dextra ...
-
bioRxiv - Immunology 2020Quote: ... 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with goat anti-mouse IgG (Southern Biotech #1030-01 ...
-
bioRxiv - Immunology 2020Quote: 96-well ELISA plates (Nunc MaxiSorp #442404) were coated with the cecal lysate (100 µL/well ...
-
bioRxiv - Immunology 2021Quote: ... white MaxiSorp ELISA plates (Thermo Fisher Scientific) were incubated with 5 μg/ml of antibodies in 100 μl phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... white MaxiSorp ELISA plates (Thermo Fisher Scientific) were incubated with 1:500 diluted plasma in 100μl phosphate-buffered saline (PBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: 96-well ELISA plates (Thermo-Fisher Scientific) were coated with 2 µg/ml SARS-CoV-2 Spike RBD-Fc protein (Sino Biological ...
-
bioRxiv - Immunology 2021Quote: ... Nunc MaxiSorp ELISA plates (Thermo Fisher Scientific) coated overnight at 4⍰°C with 2μg/well SARS-CoV-2 FL-S protein diluted in PBS were washed with PBS/Tween (0.05% v/v ...
-
bioRxiv - Immunology 2020Quote: ELISA plates (Nunc MaxiSorp, Thermo Fisher Scientific) were coated overnight at 4°C with 100 µl of prefusion-stabilized spike protein at a concentration of 1 µg/ml in 1x PBS ...
-
bioRxiv - Immunology 2020Quote: ... 96-well ELISA plates (Thermo Fisher Scientific) were coated with OMVs (100 ng/well ...
-
bioRxiv - Immunology 2020Quote: ELISA plates (Nunc MaxiSorp, Thermo Fisher Scientific) were coated overnight at 4°C with 100 µl of prefusion-stabilized spike protein at a concentration of 1 µg/ml in 1x PBS ...
-
bioRxiv - Microbiology 2019Quote: ... ELISA-grade 96 well plates (ThermoFisher Scientific) were coated with 5 µg of HA-Fc for overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates (Nunc Immuno MaxiSorp, Rochester, NY) were coated over night with Round or Rod-shaped CCMVTT-VLPs ...
-
bioRxiv - Microbiology 2023Quote: IgM and IgG ELISA: Maxisorp plates (Nunc) were coated with MPXV E8L protein solubilized in phosphate buffered saline (PBS) ...
-
bioRxiv - Microbiology 2023Quote: A/G protein ELISA: Maxisorp plates (Nunc) were coated with 100 ng MPXV E8L protein per well ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates (ThermoFisher, NUNC MaxiSorp flat bottom) were coated with antigen (300ng PPD or 150ng LAM ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates (ThermoFisher, NUNC MaxiSorp flat bottom) were coated with antigen (300ng PPD or 150ng LAM ...
-
bioRxiv - Immunology 2022Quote: Peptide ELISA: 96-well plates (ThermoFisher, 442404) were coated with 50 μl per well of a 2μg/ml Neutravidin (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: Nunc MaxiSorp ELISA plates (Thermo Fisher Scientific) were utilized and coated with 100 μL of recombinant proteins at a concentration of 1 μg ml-1 in a 1× PBS solution ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were counted every 1-3 days using CyQuant Direct Proliferation Assay kit (Life technologies). An inverted plate reader (Flexstation 3 ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...