Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2020Quote: ... 6-di-amidino-2-phenylindole (DAPI; Invitrogen) on a glass slide ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Microbiology 2021Quote: ... ATPase activity was assayed by a continuous spectrophotometric method using a 2-amino-6-mercapto-7-methylpurine ribonucleoside–purine nucleoside phosphorylase reaction to detect released inorganic phosphate (EnzChek kit; Thermo Fisher Scientific) (62) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3.3 nM of 5-chloromethylfluoresecein di-beta-D-galactopyranoside (CMFDG) (Invitrogen, Waltham, MA, USA) was added to the reaction solution ...
-
bioRxiv - Genomics 2023Quote: ... for 2 h and with 33 nM C12FDG (5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside; ThermoFisher D2893) for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in GFD medium supplemented with 5 mM L-glucose and 1 mM 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG; Invitrogen). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
Transcriptomic and morphological response of SIM-A9 mouse microglia to carbon nanotube neuro-sensorsbioRxiv - Bioengineering 2020Quote: ... and Di-2-ANEPEQ (Thermo Fisher) were reconstituted in DMSO and diluted to a working concentration of 20 μM in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Biophysics 2020Quote: ... Di-4-ANEPPDHQ and Laurdan (6-dodecanyl-2-dimethylaminonaphtalene) were from Molecular Probes (Eugene, OR). L-α-phosphatidylcholine from chicken egg (EggPC) ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2024Quote: Two million splenocytes in 200 μl PBS from WT-Foxp3YFPCre/YFPCre and Dgka-/-zf/f-Foxp3YFPCre/YFPCre mice were seeded into a U-bottom 96-well plate in the presence or absence of 100 μM 2-(N-(7-Nitrobenz-2-oxa-1, 3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; Life Technologies). After incubation at 37°C with 5% CO2 for 30min ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in glucose-free media containing 5 μg/ml 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher) and 2.5% FBS at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Cancer Biology 2020Quote: 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate (DAF) (ThermoFisher) was used to measure and spatially resolve nitric oxide (NO ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Molecular Biology 2020Quote: ... 2’-O-MOE phosphoramidites (ThermoFisher Scientific) were prepared at 0.08 M concentration in dry acetonitrile ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-Dodecanoylaminofluorescein Di-β-D-Galactopyranoside (C12FDG, cat#D2893 from ThermoFisher) was added to a final working concentration of 16,66 nM for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-2- mercaptoethanol (ThermoFisher Scientific), and 5μg/mL Puromycin (Invivogen ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Neuroscience 2024Quote: ... 2’,7’- Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein, Acetomxymethyl Ester (BCECF-AM, 5 µM) from Invitrogen. All drugs were dissolved in water and added to the standard aCSF except BCECF-AM incubated in Pluronic® F-127 (0.02% ...
-
bioRxiv - Neuroscience 2022Quote: ... Di Sodium Hydrogen O-phosphate (Fisher Scientific- 7558-79-4); Sodium Hydrogen carbonate (Fisher Scientific- 144-55-8) ...