Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 2 Amino 6 8 dimethyl 3 phenylquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... PAFB was labelled with the green fluorophore 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl ethylenediamine hydrochloride (BODIPY™ FL EDA, Invitrogen, Waltham, MA, USA) as described (32).
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... (N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY® F C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine) was purchased from Molecular Probes (Melbourne, VIC, Australia). The TiO2 was collected from a disassembled column ...
-
bioRxiv - Cancer Biology 2021Quote: ... 8 M guanidine hydrochloride (GuHCl) was obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Neuroscience 2024Quote: 6-8 dpf larvae were embedded in 2% low melt agarose (Invitrogen) on 100 mm square (Thermo Scientific (cat# 109-17) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2024Quote: Two million splenocytes in 200 μl PBS from WT-Foxp3YFPCre/YFPCre and Dgka-/-zf/f-Foxp3YFPCre/YFPCre mice were seeded into a U-bottom 96-well plate in the presence or absence of 100 μM 2-(N-(7-Nitrobenz-2-oxa-1, 3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; Life Technologies). After incubation at 37°C with 5% CO2 for 30min ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Biophysics 2024Quote: ... USA) dissolved in ethanol or 1μL 2.5mg/mL N,N-Dimethyl-6-dodecanoyl-2-naphthylamine (LAURDAN; Thermo Fisher, USA) dissolved in dimethyl sulfoxide to label the EVs ...
-
bioRxiv - Biophysics 2023Quote: ... covered with sulfosuccinimidyl 6(4-azido-2-nitrophenyl-amino) hexanoate (sulfo-SANPAH) (ThermoFisher Scientific, Loughborough, UK) 0.5 mg/mL in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Cell Biology 2023Quote: ... X-biotin-PE [N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoylsn-glycero-3-phosphoethanolamine] was obtained from Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (biotin-X DHPE; Molecular Probes, Life Technologies). Planar bilayers were formed from 200-nm liposomes in channels of a PDMS flow-cell using vesicle spreading method (36) ...
-
bioRxiv - Microbiology 2022Quote: ... and N-((6-(biotinoyl)amino)hexanoyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (biotin-X DHPE; Molecular Probes, Life Technologies). Planar bilayers were formed from 200-nm liposomes in channels of a PDMS flow-cell using vesicle spreading method (36) ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... 2% Non-essential amino acids (Gibco), 6% Sodium bicarbonate solution (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... 2% Non-essential Amino Acids (Gibco), 2.5% 1M HEPES (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... 2% non-essential amino acids (Gibco), 1% glutamine (Gibco) ...
-
bioRxiv - Biochemistry 2021Quote: ... 8 M guanidine hydrochloride (GuHCl) (for protein biology) was obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 and 8 weeks of maturation were loaded with 2.5 µM Fluo-3-AM (Molecular Probes, #F1242) dissolved in differentiation medium for 30 min at 37 °C and at 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Biophysics 2024Quote: ... and 250 µM of EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) (Thermo Scientific, 24510) in Borate buffer (100 mM Borate-NaOH ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-Nitrobenz Oxadiazol Amino Deoxyglucose (2-NBDG, Invitrogen, Cat# N13195) for 30 minutes (figure 4(a)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2% non-essential amino acids (Thermo Fisher), 2% chemically defined lipids (Thermo Fisher) ...
-
bioRxiv - Biophysics 2024Quote: ... 2% non-essential amino acid solution (Gibco), and 1mM sodium pyruvate (Gibco).
-
bioRxiv - Biophysics 2024Quote: ... 2% non-essential amino acid solution (Gibco), 1 mM sodium pyruvate (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% MEM Essential Amino Acids (ThermoFisher Scientific), 2% B27 (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2% MEM amino acid solutions (Gibco, 11140050) and 1mM Sodium pyruvate (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Neuroscience 2021Quote: ... 10% dimethyl sulfoxide and 2% (w/v) Pluronic F-127 (Invitrogen) in Ca2+/Mg2+ free pipette solution (in mM ...