Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 14 3 3 Zeta YWHAZ Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... GST-14-3-3s constructs (Invitrogen) were transformed into Escherichia coli strain BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Ywhaz (Mf029302410_m1, Invitrogen), Ubc (Mf02798368_m1 ...
-
bioRxiv - Physiology 2020Quote: ... 14-3-3ζ-specific siRNA (Ambion, Austin, TX), GFP control plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 3 μM SYTO™ 14 (Invitrogen, cat #: S7576), 5 μg/mL WGA-Alexa 555 (Invitrogen ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: ... The eight rice 14-3-3 genes cloned in the yeast two-hybrid vector pDEST22 (Invitrogen) were used from a previous study (Deb et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-Galectin-3 (1:200, Invitrogen, 14-5301-82); rabbit anti-Fibronectin (1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and YWHAZ Hs01122445_g1 (TaqMan, ThermoFisher Scientific). ACE2 and TMPRSS2 TaqMan gene expression assays used FAM-MGB dye ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-14-3-3γ 1:2000 (Thermo fisher PA5-29690) and mouse anti-GAPDH (CSB-MA000195 ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of xopX and its 14-3-3 protein binding motif mutants were cloned by Gateway cloning (Invitrogen, California) from the pENTR clones to the BiFC vector pDEST-VYCE(R)GW carrying the C-terminal region of the Venus Fluorescent Protein (VFP ...
-
bioRxiv - Microbiology 2024Quote: ... Purified cDNA was amplified for 25 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Scientific, F530L) (annealing temp 55C ...
-
bioRxiv - Microbiology 2024Quote: ... 2uL of RNase-treated cDNA was amplified for 35 cycles with VSG specific primers: a spliced-leader (5’-ACAGTTTCTGTACTATATTG-3’) and SP6-VSG 14-mer (5’-GATTTAGGTGACACTATAGTGTTAAAATATATC-3’) using Phusion polymerase (Thermo Fisher, F530L) (annealing temp 55C ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... Antibodies: Galectin 3 (Invitrogen MA1-940), Galectin 9 (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Cancer Biology 2021Quote: ... or 5ug of 14-3-3ζ expression plasmid DNA utilizing lipofectamine 2000 (Thermo Fisher Scientific) following manufacturers protocol ...
-
bioRxiv - Zoology 2022Quote: ... DsRNA concentrations were adjusted to 3 or 14 μg / μl using SpeedVac Concentrator (Thermo Scientific) and their integrity was checked on agarose gels ...
-
bioRxiv - Cell Biology 2023Quote: The siRNA sequences targeting human 14-3-3β (GenBank accession number: NM_003404.4) and human 14-3-3σ (GenBank accession number: NM_006142.5) were synthesized by ThermoFisher Scientific Ink (Massachusetts ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-aggrecan antibody BC-3 was from Thermo Scientific and anti-decorin antibody ab175404 was from Sigma.
-
bioRxiv - Cell Biology 2020Quote: ... then incubated for 3 hours in secondary antibodies (Invitrogen) used at a 1:500 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... then incubated for 3 hours in secondary antibodies (Invitrogen) at a 1:500 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... were co-transfected with lentiviral expression construct (3 µg) using Lipofectamine 2000 (14 µl; Life Technologies, 11668-019) into HEK-293T cells to generate lentivirus ...
-
bioRxiv - Cell Biology 2021Quote: ... antibodies were 3-fold serially diluted in MEM medium (Gibco) from 20 μg/mL for preparing the working solution ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibody in PBS supplemented with 3% BSA (Thermofisher, Mouse 800 ...
-
bioRxiv - Immunology 2023Quote: ... antibodies for 3 hours and stained for TMRM (Thermo Fisher) and active-Caspase3 (BD Biosciences) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Cyanine 3-conjugated anti-mouse IgG antibody (M30010, Invitrogen). Embryos were washed with PBS for three times and then PBS was replaced with 10% ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Neuroscience 2021Quote: Zebrafish larvae at 3 to 14 dpf were anesthetized with tricaine and mounted laterally in 1% low melting point agarose (ThermoFisher) on a glass bottom dish (#1.5 cover glass ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Genomics 2019Quote: ... 3 (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were washed in PBS (5 × 3 minutes) and then incubated 3 hours in a cocktail of secondary antibodies conjugated to Alexa Flour dyes (Life Technologies) to tag the primary antibodies at a concentration of 1:500 ...
-
bioRxiv - Biophysics 2019Quote: ... (3) antibody solution consisting of 100 μg/ml biotin tubulin antibodies (Thermo Fisher Scientific) in PBS that bind specifically to the F(ab’)2 fragments (incubation time 5 min) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... a mouse anti-beta 3 tubulin antibody (Invitrogen, MA1-118,1:200) was used.
-
bioRxiv - Physiology 2023Quote: ... 1.2 μg of anti-RYR1 monoclonal antibody (ThermoFisher MA 3-925,) was added to the precleared extracts and incubated 1h at 4C ...
-
bioRxiv - Immunology 2023Quote: ... Cy-3 conjugated anti-rabbit secondary antibody (Invitrogen, 1:300 dilution) was added and incubated for 0.5 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) (Invitrogen) in water for 1 hour at 60°C ...