Labshake search
Citations for Thermo Fisher :
4851 - 4900 of 10000+ citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% ACN / 0.1% formic acid at a flow of 250 nl/min for 158 min and analyzed with a QExactive Plus mass spectrometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Samples for DNA and RNA analyses were filtered (∼2 to 5 L) through triplicate 0.2 and 0.1 μm filter towers (Thermo Scientific™ Nalgene™ Rapid-Flow™ Sterile Disposable Filter Units with CN Membrane ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% acetonitrile (ACN ...
-
bioRxiv - Genomics 2020Quote: The eluted cDNA:mRNA hybrids (15 μl) were combined with second strand mix [2 μl 5× First Strand Buffer (Invitrogen), 2.31 μl Second Strand Buffer (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: mRNA from 2-5 x 104 sorted cells was captured with 12 μl of Dynabeads oligo(dT) (Life Technologies), washed ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% ACN/0.1% formic acid at a flow of 250 nL/min for 90 min and analyzed with a QExactive HF mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... coverslips were transferred to a 2 mL imaging chamber and stained with 5 μM Fura-2AM (Molecular Probes, F1221) for 30-minutes at 37°C in complete RPMI ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) was incubated using Click-iT™ Plus EdU Cell Proliferation Kit (Thermo Fisher Scientific) after DAPI staining ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were maintained in a humidified 37° C incubator with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, MilliporeSigma) supplemented with 2 mM L-Glutamine (L-Glu, Gibco), 0.1 mM non-essential amino acids (NEAA ...
-
bioRxiv - Immunology 2022Quote: ... Cells then were washed twice with FACS buffer and stained for 5 minutes at 4°C with 0.5 mg/mL of 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher). PE and DAPI staining were measured with an iQue Screener Plus flow cytometer (Intellicyt ...
-
bioRxiv - Microbiology 2022Quote: HeLa (ATCC CCL-2) cells were grown at 37 ºC and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, GIBCO) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2022Quote: ... using a trap column setup (2 cm length, 5 μm bead size, 75 μm inner diameter; Thermo Fisher Scientific) with a 25 cm separation column (2 μm bead size ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were maintained in a humidified 37° C incubator with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, MilliporeSigma) supplemented with 2 mM L-Glutamine (L-Glu, Gibco), 0.1 mM non-essential amino acids (NEAA ...
-
bioRxiv - Physiology 2022Quote: Adipocyte differentiation was induced by treating confluent cells for 2 days with 5 mg/ml insulin (Thermo Fisher Scientific) and 10μM ETYA (Santa Cruz Biotech ...
-
bioRxiv - Bioengineering 2023Quote: ... 5 × 105 HSkMC cells were incubated with 2 μg of eGFP-mRNA packaged in LPP or lipofectamine (Thermo Scientific) for 24 h in 6-well plate ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG neurons or HEK293 cells were incubated with 5 μM Fura-2 AM and 0.2% Pluronic (Thermo Fisher Scientific) (prepared from a 200 mg/ml stock solution in DMSO ...
-
bioRxiv - Neuroscience 2024Quote: Cultured sensory neurons from wild-type and TRESK-/- mice were loaded with 5 μM fura-2/AM (F1221, Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: HeLa (ATCC CCL-2) cells were grown at 37 °C and 5% CO2 in Dulbecco’s modified Eagle medium (DMEM, GIBCO) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2024Quote: ... Colon was further cut into 5-10 mm pieces and put into a 15 mL falcon tube with 5 mL prewarmed 2 mM EDTA in Hank’s balanced salt solution (HBSS, Gibco) and shaken at 250 rpm for 15 min at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... comprising 2 μl sample DNA and 48 μl reaction mixture containing per reaction 5 μl PCR buffer 10x (Invitrogen), 2 μl MgCl2 (50 mM) ...
-
bioRxiv - Neuroscience 2023Quote: ... animals were injected intraperitoneally with 5-ethynyl-2’-deoxyuridine in sterile saline (EdU, Thermo Fisher Scientific, USA, catalog #A10044), at a dose of 50mg/kg mouse on post-MCAO day 3-7 in single daily injections ...
-
bioRxiv - Neuroscience 2023Quote: EdU (5-ethylnyl-2’-deoxyuridine) was prepared according to the manufacturer’s recommendations (10mM stock solution in DMSO, ThermoFisher #C10337). This solution was then diluted in sterile PBS to achieve a final concentration of 5mg/kg body weight of the pup when injected ...
-
bioRxiv - Molecular Biology 2023Quote: ... and subjected to ultraviolet light (UV) for 5 minutes with a 2% of sulfa SANPAH solution (Thermo scientific, 22589). The hydrogels were washed several times under sterile conditions and incubated with 3.3% of Rat Tail Collagen 1 (Gibco A10483 ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100, 0.7 μL of 2% BSA, and 1.4 μL of 5× SuperScript II buffer [Thermo Fisher]). Then ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100, 0.7 μL of 2% BSA, and 1.4 μL of 5× SuperScript II buffer [Thermo Fisher]) to reduce the denaturing effect of SDc ...
-
bioRxiv - Developmental Biology 2022Quote: ... The denaturing effect of SDc was quenched by addition of 0.8 μL of 1:2500,000 diluted ERCC RNA Spike-In Mix 1 and 2.8 μL of quenching buffer (0.7 μL of Triton X-100, 0.7 μL of 2% BSA, and 1.4 μL of 5× SuperScript II buffer [Thermo Fisher]), followed by incubation at 72°C for 90 sec ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were then washed 5 times with wash buffer and 2 times with 5x SSC (Gibco ref 15557-044) + 0,1% Tween 20 ...
-
bioRxiv - Microbiology 2023Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific) using a 120 minute linear gradient for separation with two FAIMS compensation voltages (-45 ...
-
bioRxiv - Synthetic Biology 2023Quote: WT HeLa (ATCC CCL-2) were cultured at 37 °C with 5% CO2 in flasks with Dulbecco’s modified Eagle medium (DMEM) (Gibco) supplemented with 1 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in PBS/5% FBS at 37°C for 10 min or 2 μM H2-DCFDA (Thermo Fisher Scientific, C6827) in PBS/5% FBS at 37°C for 30 min ...
-
bioRxiv - Bioengineering 2023Quote: ... cerevisiae cells (OD 5-10) were pelleted and lysed in 200 µL 0.9% physiologic salt supplied with 2 µL RNAse cocktail (Invitrogen) and 5mg/mL Zymolyase 100T (MP Biomedicals) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-5 µL of 50 µM siRNA stock was resuspended in 500 µL OptiMEM reduced serum media (ThermoFisher 51985034) and gently inverted to mix ...
-
bioRxiv - Biochemistry 2024Quote: ... Reaction mixtures were adjusted to a total volume of 5 μl (2 μl solution A; 1,5 μl solution B; 0,3 μl RiboLock (40 U/μl, Thermo Scientific); 0,2 μl D-Luciferin (10 mM ...
-
bioRxiv - Microbiology 2024Quote: ... 100 µl of culture supernatant was collected and treated with 2 µl (5 U) DNase solution I (ThermoFisher Scientific) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 2-5 µg of the indicated plasmid using Lipofectamine 3000 as per manufacturer’s instructions (ThermoFisher). Transfection medium was exchanged to fresh medium and cells were moved to 10 cm plates 4-6 hours post-transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... and an Acclaim PepMap 100 trap column (100 µm x 2 cm, nanoViper, C18, 5 µm, 100Å; Thermo Scientific), the tryptic peptides were separated by increasing concentrations of 80% acetonitrile (ACN ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Physiology 2024Quote: FAP proliferation was detected using 5-ethynyl-2’-deoxyuridine (EdU)/click-it assay (cat. no.: C10337 and C10340, Invitrogen). Experiments were carried out in ECM coated 96-well half-area plates ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were washed 2× with PBSTw for 5 min each and mounted in VectaShield Antifade (Fisher Scientific, Cat# NC9532821) mounting solution and stored at 4 ℃.
-
bioRxiv - Molecular Biology 2024Quote: ... using a pre-column for sample loading (Acclaim PepMap C18, 2 cm × 0.1 mm, 5 μm, Thermo-Fisher Scientific), and a C18 analytical column (Acclaim PepMap C18 ...
-
bioRxiv - Biochemistry 2024Quote: Samples were subjected to reduction and denaturation with 5 mM tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) followed by alkylation with 15 mM chloroacetamide ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a pre-column for sample loading (Acclaim PepMap C18, 2 cm × 0.1 mm, 5 μm, Thermo Fisher Scientific), and a C18 analytical column (Acclaim PepMap C18 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a pre-column for sample loading (Acclaim PepMap C18, 2 cm × 0.1 mm, 5 μm, Thermo Fisher Scientific), and a C18 analytical column (Acclaim PepMap C18 ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA was radioactively 5' end-labeled using 1 U μl−1 T4 polynucleotide kinase (Thermo Fisher Scientific) and 0.5 μCi μl−1 32P-γ-ATP (PerkinElmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μl 10 μM 5‘-biotinylated oligo-dT30VN (IDT) and 1 μl 10 mM dNTP (Thermo Scientific). Cells were sorted at one cell per well ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were secured with a glass anchor in the bottom of a 35 mm petri dish and incubated in carbogen (5% CO2 and 95% oxygen) bubbled 3,3’-Diaminobenzidine (DAB; ACROS Organics; code: 328005000, CAS: 7411-49-6) solution (1 mg ml-1 in PBS ...
-
bioRxiv - Immunology 2021Quote: ... 2×109 1-µm Neutravidin-coated yellow-green FluoSpheres (Invitrogen #F8776) were resuspended in 1 mL of 0.1% PBS ...
-
bioRxiv - Genomics 2020Quote: ... E-cadherin (rat, Life Technologies 131900 clone ECCD-2, 1:100), Mucin 1 (Muc1 ...