Labshake search
Citations for Thermo Fisher :
4751 - 4800 of 10000+ citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... at 800 rpm for 5 minutes at room temperature and stained with LIVE/DEADTM viability/cytotoxicity kit (ThermoFisher Scientific, catalog number L3224) as the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... Protein pellets were dissolved in 200 uL 5% SDS solution and protein concentrations were determined using Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific).
-
bioRxiv - Developmental Biology 2019Quote: ... Ovaries were then washed twice for 5 minutes each with 1XPBS + 3% BSA and then carried through the Click-iT Plus EdU Imaging Kit protocol (Thermo Fisher Scientific). Ovaries were imaged on a Nikon A1R-SI+ confocal microscope and >50 stage 10 chambers were examined for EdU foci in each genotype.
-
bioRxiv - Plant Biology 2020Quote: Young seedlings were incubated in 20 μM 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit, ThermoFisher Scientific/Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cultured neurons were transfected with plasmids (1.5 μg of plasmid DNA per well) at 4 - 5 d in vitro (DIV) using a commercial calcium phosphate transfection kit (Thermo Fisher Scientific) as previously described21,24.
-
bioRxiv - Bioengineering 2020Quote: The IGFBP-derived NLS peptides (NLS-3 and NLS-5) were extracted from the bacteria using the B-Per 6xHis Fusion Protein Purification Kit (Thermo Scientific, USA), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: 10 ng total RNA containing 5 pM ath-miR-159a spike-in was reverse-transcribed using Taqman Advanced miRNA cDNA synthesis kit (Applied Biosystems #A28007) and miRNAs were detected using specific probes for ath-miR159a (478411_mir) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three to six transformed colonies were cultured in 5 ml of LB medium and plasmids were subsequently purified with a GeneJET Plasmid Miniprep kit (Thermo Fisher Scientific). Purified plasmids were sequenced by Eurofins Genomics.
-
bioRxiv - Genetics 2020Quote: Proteins were extracted form 20 μL of ammonium bicarbonate resuspended fractions by adding 5 μL of lysis buffer (10% NP40, 2%SDS in PBS) and quantified by BCA protein assay kit (ThermoFisher Scientific, 23225).
-
bioRxiv - Immunology 2021Quote: ... RT-PCR was performed using OC43-nucleocapsid specific TaqMan primers and a probe 18 fluorescent- labelled with a 5’-FAM reporter dye and 3’-BHQ quencher (IDT) and AgPath-ID™ One-Step RT-PCR kit (AgPath AM1005, Applied Biosystems) on an ABI QuantStudio 3 platform (Thermo Fisher) ...
-
bioRxiv - Physiology 2020Quote: ... and lysed in a minimum of 5 µL Cells-to-CT buffer containing 1% DNAse I (Taqman Gene Expression Cells-to-CT Kit, Thermo Fisher Scientific), or a volume adjusted for a final cell concentration of ∼1000 cells/µL for 5 min at RT ...
-
bioRxiv - Physiology 2020Quote: ... as well as non-specific negative control oligonucleotides (5′-AAATGTACTGCGCGTGGAGAC-3′) were cloned into pcDNA6.2-GW/EmGFP-miR [“BLOCK-iT™ PolII miR RNAi Expression Vector Kit” (Invitrogen, Darmstadt, DEU). Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119) ...
-
bioRxiv - Bioengineering 2021Quote: ... These were then treated with 10 µM Ethidium Homodimer-1 and 5 uM Calcein AM from a Live/Dead Test Kit (Molecular Probes, Thermofisher Scientific) to a total volume of 250 uL PBS and incubated (37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... S1-RBD and ACE2 recombinant proteins were expressed in Expi293 cells for 5 days following transient transfection using Expifectamine 293 Transfection Kit (Thermo Fisher Scientific). Cell cultures were centrifuged at 4500g for 40 min ...
-
bioRxiv - Neuroscience 2022Quote: ... except that they also received 2 injections of 10 mg/kg 5-ethynyl-2’-deoxyuridine (EdU) from the Click-iT EdU Alexa Fluor 647 imaging kit (Invitrogen, Carlsbad, CA), the day after DOX injection (4 DPN ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2-cell stage embryos were transferred to new KSOM containing 1 mM 5-ethynyl uridine (EU, from Click-iT RNA Alexa Fluor 488 Imaging Kit, Thermo Fisher Scientific) and cultured for 1h at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2022Quote: ... 2.2 mM LAP was added to half of the samples and 10 µM 5-ethynyl-2’-deoxyuridine (EdU) solution from a Click-iT Plus EdU Cell Proliferation Kit (cat. no. C10637; Invitrogen, Waltham, MA) was added to the other half according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... RT was performed with 5-10 μg of DNase-treated total RNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) and RT reactions were carried out according to the manufacturer’s instructions with random primers ...
-
bioRxiv - Genomics 2022Quote: Approximately 5 μg of total purified RNA were then treated with the Turbo DNA-free kit (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Aliquots were taken for flow cytometry measurement with SYBR Green I and MitoProbe DiIC1(5) kit (both Thermo Fisher Scientific, Waltham, MA). Primed samples were compared to non-primed counterparts for reduction in growth ...
-
bioRxiv - Neuroscience 2024Quote: ... the PCR products from using the primer DBH-WT-F and DBH-3’junc-R 5’- TCTGAAGAATAGCTTCTCACAAgagctcag were subcloned into the pCR Blunt II TOPO vector (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific) and sequenced using M13-Foward and M13-Reverse primers.
-
bioRxiv - Microbiology 2024Quote: ... and 1492R (5’-TACGGYTACCTTGTTACGACTT-3’) [29–31] with the Invitrogen Platinum II Taq Hot-Start DNA Polymerase kit (Cat. No. 14966001, Invitrogen, Waltham, MA). The 16S rRNA gene amplicons were sequenced by GENEWIZ (Azenta Life Sciences ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 3-times for 5 min in TBS and the signal was amplified with a CF® 594 tyramide signal amplification kit (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... Substrate-induced changes of cell proliferation were analyzed after 5 days of culture using the Click-iT EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... qRT-PCR was performed using DyNAmo ColorFlash SYBR Green qPCR Kit in the ABI Quant Studio 5 Sequence Detection System (Life Technologies, USA). The expression of the genes of interest was analyzed by the ΔΔCt method using ATP5G rRNA and GAPDH as internal control genes ...
-
bioRxiv - Microbiology 2023Quote: ... Positive transformants were inoculated in 5 mL liquid LB medium (omitting the Bacto agar) and plasmids were isolated using a GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific). Correct plasmid structure was confirmed using restriction analysis using the FastDigest KpnI enzyme (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...
-
bioRxiv - Developmental Biology 2023Quote: ... R: 5′- AAAGCACCGACTCGGTGCCAC-3′) and used as a template for in vitro transcription using MEGAshortscript T7 kit (Ambion/Thermo Fisher Scientific AM1354). 2ng gRNA was injected together with 1.9nM Cas9 protein (New England Biolabs M0386T ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA was synthesized using 5 µg RNA as a template per reaction with the Superscript III First Strand Synthesis System Kit (Invitrogen, 18080-051) and its provided random hexamers ...
-
bioRxiv - Genomics 2022Quote: ... One-step reverse transcription and real-time PCR was performed with a Quantstudio 5 using Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) following the manufacturer protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The library is quantified through qPCR (Invitrogen™ Collibri™ Library Quantification Kit; QuantStudio™ 5 Real Time PCR Systems, APPLIED BIOSYSTEMS).
-
bioRxiv - Plant Biology 2024Quote: RNA ligase-mediated rapid amplification of cDNA ends (5’-RLM-RACE) was performed using FirstChoice® RLM-RACE kit (Thermo Fisher Scientific) following the manufacturer protocol and omitting the dephosphorylation and decapping steps ...
-
bioRxiv - Biochemistry 2024Quote: ... Complementary DNA (cDNA) was synthesized from 5 µg of the total RNA using the SuperScript IV Reverse Transcriptase Kit (Thermo Fisher Scientific) following the manufacturer’s recommendations.
-
bioRxiv - Immunology 2024Quote: ... qPCR was performed on an Applied Biosystems Quantstudio 5 machine using the AgPath-ID One-Step RT-PCR kit (Applied Biosystems, 4387391) and Taqman primers as per manufacturer recommendations ...
-
bioRxiv - Physiology 2024Quote: ... One-step reverse transcription and real-time PCR was performed with a Quantstudio 5 using Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) following the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... Phase separation in cells lysed in TRIzol was induced with 50% isopropanol and 0.5% 2-mercaptoethanol and RNA was extracted from the aqueous phase using the MagMAX mirVana Total RNA Isolation Kit (Thermo Fisher, A27828) on a KingFisher Flex Magnetic Particle Processor according to the manufacturer’s protocol with 1-2 million cells input ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4mM L-Glutamine and 1X ITS (5 μg/mL insulin, 5 μg/mL transferrin, 5 ng/mL selenium) (all from Gibco, Thermo Fisher Scientific, Waltham, MA). The Wit49 cell line was a gift from Dr ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 days post-transfection cells were selected with 5 μg/mL blasticidin (Thermo Fisher Scientific). When the survival rate of the cells improved ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μl 10x Turbo DNase buffer and 5 μl 2U/μl TurboDNase (Thermo Fisher Scientific) were added to 85 μl of sample and incubated for 20-30 min at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... ×5 mm C18 PepMap 100 trap column with 5 μm particle size (Thermo Fisher Scientific) to desalt and concentrate the samples before loading onto the C18 nanocolumn for separation ...
-
bioRxiv - Biophysics 2021Quote: ... stock was prepared at 5 mg/mL in dimethyl sulfoxide (#67-68-5, Fisher Scientific) and stored at −20 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 1x 10^5 cells were resuspended in water containing 5 µM propidium iodide (ThermoFisher Scientific) and incubated at room temperature for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Genomics 2019Quote: ... Selected cells were frozen at 5 × 106 cells/mL in 5% DMSO (Thermo Fisher Scientific) and aliquots were used in the genomic MPRA.
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Biochemistry 2019Quote: ... ×5 mm C18 PepMap 100 trap column with 5 μm particle size (Thermo Fisher Scientific) to desalt and concentrate the samples before loading onto the C18 nanocolumn for separation ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% (v/v) human serum (PAA Laboratories GmbH) and 5 % v/v Albumax II (Invitrogen) at 37°C in a gas environment of 5 % CO2 ...
-
bioRxiv - Immunology 2023Quote: ... and STX-S_pLenti at a ratio of 5:5:1 using Lipofectamine 3000 (ThermoFisher, L3000008) according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: ... and a C18 PepMap 100 trap column (5 mm × 300, 5 μm, Thermo Fisher Scientific). Samples were eluted over a 90 min gradient from 0 to 35% acetonitrile at a flow rate of 0.3 μL/min ...