Labshake search
Citations for Thermo Fisher :
4551 - 4600 of 6821 citations for Recombinant Human IL1RL1 None tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: Cryopreserved T cells were thawed and activated same day with Human T-Expander CD3/CD28 Dynabeads (Gibco) at 3:1 beads:cell ratio in T cell media (AIMV supplemented with 5% FBS ...
-
bioRxiv - Developmental Biology 2020Quote: Primary prenatal human microglia were MACS-purified as described above and labeled with DiI (Thermo Fisher, V22885) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Alexa Fluor conjugated secondary antibodies used: goat anti-human Alexa-488 (1:1000, Cat. # A11013, Life Technologies), donkey anti-mouse Alexa-594 (1:1000 ...
-
bioRxiv - Systems Biology 2019Quote: Full-length cDNAs were obtained from the human ORFeome v5.1 entry clone collection (Thermo Fisher, Open Biosystems) and sequence verified ...
-
bioRxiv - Immunology 2019Quote: ... Corresponding cDNAs were made by gene synthesis and codon-optimised for expression in human cells (Invitrogen, GeneArt). The ectodomains were flanked by unique NotI and AscI restriction enzyme sites and subcloned into an expression plasmid containing a high-scoring signal peptide [29] ...
-
bioRxiv - Microbiology 2019Quote: ... transformed into MaV203 and used as a bait to screen a human embryonic brain cDNA library (Invitrogen). Media ...
-
bioRxiv - Biochemistry 2019Quote: ... the human cell lines were seeded (1000 cells/well) using a multi-drop Combi (Thermo Fisher Scientific) on top of the compounds ...
-
bioRxiv - Microbiology 2021Quote: Human embryonic kidney 293 Freestyle (HEK293F) cells were maintained in Expi293 Expression Medium (Gibco, Waltham, MA, USA), at 37 °C in an 8% CO2 atmosphere ...
-
bioRxiv - Immunology 2021Quote: ... Human or mouse cell suspensions were seeded at approximately 2900 cells/cm2 in αMEM complete media (Invitrogen) and cultured in 10% batch selected FBS (Sigma Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... Human PDCD1 or PDL1 cell surface protein staining was analyzed using anti-PD-1 (ThermoFisher clone MIH4) or anti-PD-L1 (ThermoFisher clone MIH1 ...
-
bioRxiv - Neuroscience 2020Quote: ... the medium was changed to human endothelial serum-free medium (HESFM, Thermo Fisher Scientific, cat no. 11111044) supplemented with 20 ng/mL bFGF (Peprotech ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA from HEK293 cells and human brain prefrontal cortex were isolated with the TRIzol reagent (Ambion) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... Caco-2 human colorectal adenocarcinoma (ATCC HTB-37) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (GibCo) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2020Quote: Human colon adenocarcinoma cells (Caco-2) were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5μl were used for quantitative PCR with primer/probe sets for human GAPDH (Applied Biosystems Cat# Hs99999905_m1) and HIV-1 genomic RNA (primers GGCCAGGGAATTTTCTTCAGA / TTGTCTCTTCCCCAAACCTGA (forward/reverse ...
-
bioRxiv - Biophysics 2021Quote: The cDNA of human PDI (residues 18-479) was cloned into a pBAD vector expression system (ThermoFisher) and modified to include an N-terminal 6 his-tag and a C-terminal Avitag ...
-
bioRxiv - Biophysics 2021Quote: ... and both HRP-conjugated anti-mouse IgG Fc and anti-human IgG Fc were purchased from Invitrogen™ (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... BHLHE41 expression in human B cell subsets was assessed by PrimeFlow RNA assay (Thermo Fisher, Oberhausen, Germany) with high sensitivity Alexa Fluor 647-probe targeting human BHLHE41 normalized on CD8A-probe.
-
bioRxiv - Cancer Biology 2021Quote: ... and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, France). All the media were supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco, Thermo Fisher Scientific, France). All the media were supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2020Quote: ... Fifty microliter clots were formed from purified fibrinogen using 0.25 U/mL human alpha-thrombin (Fisher Scientific), 2 mg/mL fibrinogen (Enzyme Research Laboratories) ...
-
bioRxiv - Bioengineering 2021Quote: ... Human lung (Calu-3) (ATCC, HTB-55) cells were cultured in Minimum Essential Media (MEM) (Gibco; 11095080) supplemented with 10% FBS with 1mM sodium pyruvate (Gibco ...
-
bioRxiv - Bioengineering 2021Quote: T cells from 3 donors were thawed and activated using Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: Human iPSCs (male WTC11 background24) were cultured in Essential 8 (E8) Medium (ThermoFisher Scientific cat. no. A1517001) on BioLite Cell Culture Treated Dishes (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... small interfering RNAs (siRNAs) targeting human MPI were transfected using Lipofectamine RNAiMAX transfection reagent (ThermoFisher, Waltham, MA), as previously described (15) ...
-
bioRxiv - Systems Biology 2021Quote: ... MDA-MB-231 human breast cancer cells were cultured in DMEM/F12 (1:1) media52 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... secondary antibody (chicken anti-rabbit Alexa Fluor-488, Invitrogen, or goat anti-human Alexa Fluor-488, Invitrogen) diluted 1:400 in PBS containing 0.1% (v/v ...
-
bioRxiv - Systems Biology 2021Quote: Human gingival tissues were minced and digested for 50 minutes at 37°C with Collagenase IV (Gibco) and DNAse (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: Aβ concentration in conditioned medium from individual wells measured using the human Aβ42 ELISA kit (Thermo Fisher), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Human hepatocytes (male donor, age 57) were maintained in DMEM with 10% fetal bovine serum (FBS, GIBCO), 1% ITS (insulin/transferrin/selenous acid and linoleic acid ...
-
bioRxiv - Microbiology 2021Quote: ... Goat anti-mouse and anti-human antibodies pre-coupled to Alexa Fluor 647 (Invitrogen, Rockford, IL, USA) were used as secondary antibodies in flow cytometry experiments ...
-
bioRxiv - Microbiology 2021Quote: ... 50 µL of a 1:100 dilution of mouse anti-human IgM phycoerythrin conjugate (Invitrogen, MA1-10381) or goat anti-human IgG phycoerythrin conjugate (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... The human glioma cell lines were cultured in DMEM containing 2mM L-glutamine (ThermoFisher Scientific, 25030-24), non-essential amino acids (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and Rabbit anti-Human IgG F(ab’)2 HRP Secondary Antibody (ThermoFisher Scientific Catalog #31482, 1:10,000).
-
bioRxiv - Neuroscience 2020Quote: Human H4 neuroglioma cells were maintained at 37°C in OPTI-MEM I (Gibco, Invitrogen, CA, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2020Quote: Human H4 neuroglioma cells were maintained at 37°C in OPTI-MEM I (Gibco, Invitrogen, CA, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... The secondary anti-human TRITC antibody (Thermo Fisher; 1:200 in 0.01% acBSA in PBS, pH 7.2) was used in this assay ...
-
bioRxiv - Microbiology 2021Quote: ... cells were further stained using alexa-555 conjugated donkey anti-human IgG (Thermo Fisher Scientific, Cat# A21433). After extensive washing ...
-
bioRxiv - Molecular Biology 2020Quote: Human β-cells were seeded onto collagen coated 8-well chambered cover glasses (Lab-Tek, Thermo Scientific) at a density of 70,000 cells/cm2 ...
-
bioRxiv - Microbiology 2020Quote: The concentration of culture supernatants and MMP-9 were measured by Human MMP-9 ELISA Kit (Invitrogen) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... Standard curves were obtained by dilutions in PBS of purified human IgG (Cat. 02-7102, Invitrogen, USA) or IgA (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human embryonic kidney 293 (HEK-293T) cells were stably transfected with the plasmids using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Released IL-1β was quantified using the Human IL-1 beta ELISA Ready-Set-Go! Kit (ThermoFisher) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 datasets in which 163 samples were analyzed using the GPL96 (Affymetrix Human Genome U133A Array) platform and 80 samples were analyzed using GPL570 (Affymetrix Human Genome U133 Plus 2.0 Array ...
-
Pseudohypoxic HIF pathway activation dysregulates collagen structure-function in human lung fibrosisbioRxiv - Cell Biology 2021Quote: ... cDNA libraries were prepared using Ion Ampli-Seq-transcriptome human gene expression kit (Life Technologies, Paisley, UK) and sequenced using Ion Torrent Proton Sequencer ...
-
bioRxiv - Neuroscience 2022Quote: OPG in the CSF was measured using the Human TNFRSF11B(OPG) Elisa kit (Thermo Fisher Scientific, Germany). The assay was performed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Wells were then incubated with a secondary goat anti-human IgG labelled with horseradish peroxidase (HRP) (Invitrogen) or with a rabbit polyclonal anti-human IgA alpha-chain labelled with HRP (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: After treatment of undifferentiated human iPSCs with a final concentration of 0.1 μg/mL Colcemid (Thermo Scientific) for 2 h ...
-
bioRxiv - Biochemistry 2022Quote: ... and BT474 human breast ductal carcinoma cells purchased from ATCC (LGC Promochem) were cultured in DMEM (Invitrogen) and supplemented with 10 % fetal calf serum (PAA Lab-oratories) ...
-
bioRxiv - Molecular Biology 2022Quote: The human hepatic Huh7 cells (JCRB0403) were maintained in Dulbecco’s modified eagle medium (DMEM, Gibco, the Netherlands) containing 10% fetal bovine serum (FBS) ...