Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for lefty A TGF beta 4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... HEK293S GnTl- cells were cultured in Freestyle 293 (GIBCO) supplemented with 2% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... and HEK293 or RPMI 1640 (ATCC modification) (ThermoFisher, A1049101) (for Jurkat cells complete with 5% pen/strep and 10% FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... HEK293 cells were grown in RPMI 1640 medium (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... HEK293 cells were transfected using lipofectamine 2000 (Thermofisher, USA) following the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293 cells were propagated in MEM with GlutaMAXTM (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293-FT (RRID: CVCL_6911) was purchased from Thermo Fisher Scientific (#R70007) ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... His-Tag purification was performed using Dynabeads His-Tag Isolation and Pulldown (Invitrogen, 10103D). Beads were allowed to bind to antibody-pA-Tn5 complex for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... His-tagged CDC50A was detected using a His-probeTM -HRP from Thermo Scientific (15165). Precast stain-free gradient gels for tryptophan fluorescence (4568084 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Organoids were thereafter exposed to the indicated concentration of TGF-β1 (Thermo Fisher). To assess viability of the organoids ...
-
bioRxiv - Cancer Biology 2022Quote: ... organoid growth medium was supplemented with 10 ng/ml TGF-β1 (Thermo Fisher). 96 hours after seeding ...
-
bioRxiv - Microbiology 2020Quote: ... and PDGF-D by enzyme-linked immunosorbent assay (ELISA, TGF-β: Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: Mouse TGF-β 1 recombinant protein was obtained from Affymetrix (#14-8342-62) and used at the concentration of 2 ng/ml unless stated otherwise ...
-
bioRxiv - Molecular Biology 2022Quote: ... TGF-β1 siRNA and control siRNAs were from Ambion (Foster City, CA, USA). Fibronectin siRNA was custom-synthesized by Eurogentec (Liège ...
-
bioRxiv - Pathology 2023Quote: ... The protein levels of TGF-β (88-50680-22, Thermo Fisher Scientific, JPN), HA (Hyaluronan Quantikine ELISA Kit ...
-
bioRxiv - Pathology 2023Quote: ... The protein levels of TGF-β (88-50680-22, Thermo Fisher Scientific, JPN), HA (Hyaluronan Quantikine ELISA Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10% HI FBS (Gibco A31604), and pen/strep and seeded into 96-well plates 24 hr prior to treatment ...
-
bioRxiv - Neuroscience 2022Quote: ... and pcDNA3.1/myc-His (Invitrogen). Constructs for hTara mutants were prepared by cloning into pEGFP-C3 ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibody (Anti-His; Invitrogen, Waltham ...
-
bioRxiv - Immunology 2022Quote: ... + 10% HI-FBS (Gibco, 16140071) + 10% HI-Horse Serum (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.5% HI FBS (Gibco). Neutrophils were recovered from the bottom of the tube.
-
bioRxiv - Microbiology 2023Quote: ... GFP-His (Thermo Fisher # A42613), NL63 N-His (Sino Biological # 40641-V07E) ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-bind magnetic Dynabeads (Invitrogen) were washed with TBS containing 0.05% Tween-20 (TBS-T ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.5% HI FBS (Gibco).
-
bioRxiv - Molecular Biology 2023Quote: ... anti-His (ThermoFisher scientific, rd230540a), anti-SETD6 (Genetex ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 2% HI FBS (Gibco) and 0.4% 0.5M EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and 10% HI FBS (Gibco). Media were supplemented with interleukin-2 (IL-2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-Microglobulin-Mm00437762_m1 (Applied Biosystems, Waltham, MA). Gene expression levels were normalized to β-2-microglobulin ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4ng/ml beta-FGF (Thermo Scientific®; RFGFB50), 50nM PMA (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 mM Beta-Mercaptoethanol (Gibco, Cat. No. 31350010), 1000 units/mL LIF (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-Beta Galactosidase (1:1000, Life Technologies), mouse anti-Beta Galactosidase (1:1000 ...
-
bioRxiv - Genomics 2021Quote: ... 2 μl of beta-agarase (Thermo Fisher Scientific) were added for agarose digestion and the reaction was incubated at 43 °C for 45 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.1 mM Beta-mercaptoethanol (Fisher Scientific, #21985-023), Primocin (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2% n-Dodecyl-beta-Maltoside Detergent (Thermo Scientific). For lysis tests ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.055 mM beta-mercaptoethanol (Thermo Fisher Scientific), with fresh medium added weekly ...
-
bioRxiv - Microbiology 2023Quote: ... and beta-actin (Thermo Fisher Scientific, MA5-15739). Fluorescent secondary antibodies were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... and electroporated into MegaX 10 beta cells (Invitrogen). Transformations were recovered in 1mL of SOC for 1hr at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 0.1% beta-Mercaptoethanol (2-Me; Gibco, Darmstadt, Germany) and 100 U/ml Penicillin and 100 μg/ml Streptomycin at 37 °C in a humidified environment at 5% CO2.
-
bioRxiv - Immunology 2022Quote: Expression vectors for human His-NLRP1PYD (aa 1-92) and GST-NLRP1PYD were generated by Gateway cloning with destination vector pDEST17 (Thermo Fisher Scientific) and a customized destination vector based on pGEX-2T (a kind gift of Mikko Taipale ...
-
bioRxiv - Immunology 2021Quote: ... and RBD-his tag protein-bound antibody was detected with goat-anti-human IgG1 (H+L) with horseradish peroxidase (HRP) conjugated (Invitrogen,1:1000) The plates were washed and developed using TMB substrate solution (Biolegend ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5) into pcDNATM4/V5-HisB (Invitrogen catalog number V861-20). pLenti–hVMP1–FLAG was obtained by inserting the oligonucleotide MCS-flag into pENTR1A (Addgene Plasmid #17398) ...
-
bioRxiv - Molecular Biology 2020Quote: 6xHis-tagged REV-ERBβ LBD (4 nM) was incubated with anti-His antibody conjugated to terbium (1 nM) (ThermoFisher #PV5863) and FITC-labeled NCoR ID1 or NCoR ID2 peptide (400 nM ...