Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for West Nile Virus NS1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Microbiology 2022Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Microbiology 2019Quote: ... The viral N-protein was labeled using a primary anti-Tula virus antibody(12) and a secondary anti-rabbit FITC conjugate (Invitrogen, USA). The viral Gc protein was stained using a mouse monoclonal antibody (#H1808-60B ...
-
bioRxiv - Bioengineering 2023Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... 1 ml of mid-exponential growth phase cells (OD600 of 0.6-0.8) was mixed with 5 µg/ml Nile red (Invitrogen) and 1 µg/ml Hoechst 33342 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 ml aliquot of each culture was incubated with 2.5 µg/ml Nile Red (membrane stain, Invitrogen) for 5 min at 37 °C with shaking ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Microbiology 2020Quote: ... and chemiluminescence signal was detected by using West Pico or West Femto Chemiluminescence Reagent (Thermo Scientific, Waltham, MA). The protein bands were quantified by using Imagelab-Chemidoc (Bio-rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... the membranes were washed again 3 times for 10 minutes with 1x TBST and proteins were visualized using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). Signals were digitally captured on a Fusion Solo S (Witec ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein bands were visualized using a LI-COR Odyssey FC Imaging system and Super Signal West Pico Chemiluminescent Substrate (Thermo Fisher). Western blots were quantified using Image Studio Software ...
-
bioRxiv - Physiology 2020Quote: ... The immunoreactivity of the proteins was detected and visualized after incubating the membranes with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo scientific). GAPDH was used as a loading control ...
-
bioRxiv - Molecular Biology 2021Quote: ... blots were incubated with HRP conjugated secondary antibody and proteins were imaged by chemical luminescence using Super Signal West Pico (Thermo Scientific).
-
bioRxiv - Bioengineering 2020Quote: ... loading 5 μg of protein lysate in each lane and using a SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) or a SuperSignal West Pico PLUS Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... was used as a secondary antibody and the resulting proteins of interest were visualized with SuperSignal West chemiluminescent substrate (Thermo Fisher). Ponceau S or Amido Black staining was performed to verify equal loading.
-
bioRxiv - Microbiology 2023Quote: ... membranes were washed with TBST for 30 min and specific protein bands were detected by chemiluminescence using SuperSignal West Femto maximum sensitivity substrate (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were detected by using horse radish peroxidase (HRP)-conjugated secondary antibodies and SuperSignal West Dura Extended Duration Substrate (Thermo Scientific). Images were taken with a ChemiDoc Imaging system (Bio-Rad).
-
“Identification of microRNAs regulated by E2F transcription factors in human pluripotent stem cells”bioRxiv - Developmental Biology 2024Quote: ... Membranes were then incubated with the corresponding counter-antibody and the proteins were revealed by enhanced chemiluminescence detection (SuperSignal West Femto System, Thermo Scientific). For information about the antibodies used please see Supplementary Table S3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and Super Signal West Dura (Thermo Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... or SuperSignal West Femto (Thermo Scientific, 34094). All chemiluminescence was detected using a ChemiDoc MP system (BioRad).
-
bioRxiv - Cell Biology 2019Quote: ... and SuperSignal West Femto (34094, Fisher Scientific).
-
bioRxiv - Microbiology 2019Quote: ... SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher) was used to visualize bound antibody.
-
bioRxiv - Cell Biology 2022Quote: ... and supersignal west pico plus (Invitrogen, 34,580) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific) was incubated with the membrane and protein was visualized using a Biorad ChemiDoc™ Image System.
-
bioRxiv - Systems Biology 2020Quote: ... and SuperSignal West Femto substrate (Thermo Scientific) using standard Western blot protocols (34) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or SuperSignal West Femto (Thermo Fisher Scientific) substrates ...
-
bioRxiv - Biophysics 2020Quote: ... and Super Signal West Femto Substrate (ThermoFisher) in a 1:10 ratio.
-
bioRxiv - Microbiology 2020Quote: ... Super Signal West Dura Kit (Thermo Scientific) was used for signal development according to manufacturer’s recommendations and the chemiluminescence was detected with a ChemiDoc Imager (BioRad).
-
bioRxiv - Biochemistry 2020Quote: ... SuperSignal West Pico Chemiluminescent substrate (Thermo Scientific) was used to develop the blots ...
-
bioRxiv - Neuroscience 2020Quote: ... SuperSignal West Pico ChemiluminescentSubstrate (Thermo Fisher Scientific) was applied to visualize HRP labelled antibodies and developed using the FUJIFILM Luminescent Image Analyzer LAS-1000 plus & Intelligent Dark Box II (Fujifilm) ...
-
bioRxiv - Biochemistry 2020Quote: ... the Super Signal West Pico (Thermo Scientific) substrate was used according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or SuperSignal West Femto (Thermo Fisher; 34094) and imaging (Amersham 600 ...
-
bioRxiv - Neuroscience 2020Quote: ... SuperSignal™ West Pico Substrate (Thermo Scientific) was used for chemiluminescent detection of bound proteins ...
-
bioRxiv - Microbiology 2021Quote: ... and SuperSignal Femto West (Thermo Fisher Scientific) were used to detect primary antibody binding ...
-
bioRxiv - Cell Biology 2021Quote: ... or SuperSignal West Femto (Thermo Scientific, 34095) depending on the strength of the signal ...
-
bioRxiv - Molecular Biology 2022Quote: ... Super Signal West Pico (Thermo Fisher Scientific) was used for blot visualization by chemiluminescence using the ChemiDoc Touch Imaging System (Bio-Rad).
-
bioRxiv - Microbiology 2021Quote: ... SuperSignal West Pico Plus (Thermo Fisher Scientific) was applied to detect relative protein concentrations.
-
bioRxiv - Neuroscience 2022Quote: ... or SuperSignal West Dura Substrate (Thermo Fisher) was used for protein visualization ...
-
bioRxiv - Cancer Biology 2019Quote: ... and SuperSignal West Chemiluminescent Substrate (Thermo Scientific) for 5 min ...
-
bioRxiv - Biochemistry 2019Quote: ... SuperSignal West Pico PLUS (Thermo Fisher Scientific) was used as the ECL substrate ...
-
bioRxiv - Microbiology 2020Quote: ... SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher) was used to develop the blots ...
-
bioRxiv - Biochemistry 2021Quote: ... and Super Signal West Femto Substrate (ThermoFisher) in a 1:10 ratio.
-
bioRxiv - Cancer Biology 2021Quote: ... or West Femto ECL (Thermo Fisher Scientific). Quantitation was performed using Image Lab software.
-
bioRxiv - Molecular Biology 2021Quote: ... West Femto Maximum Sensitivity Substrate (ThermoFisher, 34094), or West Atto Ultimate Sensitivity Substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... West Dura Extended Duration Substrate (ThermoFisher, 34075), West Femto Maximum Sensitivity Substrate (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... or SuperSignal West Dura reagents (Thermo Scientific).
-
bioRxiv - Microbiology 2022Quote: ... Supersignal West Pico PLUS (Thermo-Fisher Scientific) was used to measure relative protein concentrations.
-
bioRxiv - Immunology 2022Quote: ... SuperSignal West Pico PLUS (34577, Thermo Fisher) or SuperSignal West Femto (34095 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and SuperSignal Femto West (Thermo Fisher Scientific) were used to detect primary antibody binding ...
-
bioRxiv - Cancer Biology 2022Quote: ... or SuperSignal West Femto (Thermo Fisher Scientific) and the ChemiDoc Touch Imaging System (Biorad ...
-
bioRxiv - Cancer Biology 2022Quote: ... with SuperSignal West Femto (Thermo Fisher Scientific) substrates ...