Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Rat N Myc Proto Oncogene Protein MYCN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The ELISA was performed using Human IL-1β high sensitivity kit from Invitrogen. The sample of ELISA used in the present study consist of cell culture media (referred to as sample hereafter ...
-
bioRxiv - Cell Biology 2021Quote: ... Adiponectin was measured using an ELISA kit from Invitrogen (Catalog number: EZMADP-60K). Serum insulin levels were measured using ALPCO Mouse Insulin ELISA Jumbo kit (Cat ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies were isotyped using the Rapid ELISA Mouse mAbs Isotyping Kit (ThermoFisher Pierce) with anti-mouse heavy chain capture antibody (anti-IgG1 ...
-
bioRxiv - Immunology 2021Quote: Cytokine concentration was measured by using IL-6 Mouse Uncoated ELISA Kit (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: mMCPT-1 was detected using the MCPT-1 mouse uncoated ELISA kit (ThermoFisher) following the protocol provided by manufacturer ...
-
bioRxiv - Molecular Biology 2022Quote: ... or PBS control was done using the SIgA Mouse Uncoated ELISA kit (Invitrogen) following manufacturer’s instructions ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: IFN-α levels were analyzed with commercial ELISA assay kits (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and by the IL-27 Mouse ELISA kit (Thermo Fisher Scientific, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Secreted APOE was measured using human APOE ELISA kit (Thermo Fisher Scientific, EHAPOE) following manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The ELISA was performed using Human IL-1b high sensitivity kit from Invitrogen. The samples for ELISA were media collected after treating the cells with drugs at 100uM ...
-
bioRxiv - Immunology 2023Quote: ... and TNFα Ready-Set-Go ELISA kits per manufacturers protocols (ThermoFisher, Waltham, MA).
-
bioRxiv - Cell Biology 2023Quote: The insulin enzyme-linked immunosorbent assay (ELISA) kits were purchased from Thermofisher (EMINS) and Sigma (RAB0327) ...
-
A balance between pro-inflammatory and pro-reparative macrophages is observed in regenerative D-MAPSbioRxiv - Bioengineering 2023Quote: All ELISA kits for quantifying different cytokine expression were purchased from Thermo Fisher Scientific and the experiment was performed according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasma TNF-α was determined using TNF-α ELISA kit (Invitrogen, Waltham, MA) following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... and urea secretion were determined with the AFP Human ELISA Kit (Invitrogen, EHAFP) (1:3000 dilution) ...
-
bioRxiv - Molecular Biology 2023Quote: ... IP-10 levels were analyzed with commercial ELISA assay kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Plasma renin was measured using the Mouse Renin 1 (REN1) ELISA Kit (Invitrogen) and plasma ACTH was measured using Mouse/Rat ACTH SimpleStep ELISA® Kit (Abcam) ...
-
bioRxiv - Biochemistry 2023Quote: HIF-1α was evaluated using a HIF-1 Alpha ELISA Kit (Invitrogen™). Procedure steps were followed according to the manufacturer’s instructions and results were monitored at 450 nm ...
-
bioRxiv - Immunology 2024Quote: ... the supernatant was collected and analyzed with ELISA kits for IFNγ (Life Technologies) and TNFα (Proteintech ...
-
bioRxiv - Biochemistry 2023Quote: ... Promega) or Myc-C/EBPβ expression vector (pLVSIN-Myc-C/EBPβ) using Lipofectamine 3000 (Thermo Fisher Scientific) for 24 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2µg MNS1-HA/2µg MNS1-Myc and 2µg CFAP53-HA/2µg CFAP53-Myc plasmids were incubated with 20µl of Lipofectamine 2000 (Invitrogen) in 300 µl Optimal MEM (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... Final water-PAAm mixtures were crosslinked with 0.5% APS and 0.15% N,N,N′,N′-tetramethylethylenediamine (ThermoFisher, 17919). 50 μL of the mixtures were added to each glass and allowed to crosslink for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... ELISA plates were developed using the Turbo TMB-ELISA (Fisher Scientific) and the reaction was stopped by addition of 2N H2SO4 ...
-
bioRxiv - Biochemistry 2023Quote: ... All ELISA experiments were performed on 96-well ELISA plates (Nunc) coated overnight with 2 µg/mL neutravidin and blocked for at least two hours with selection buffer ...
-
bioRxiv - Immunology 2020Quote: ... IgM, and IgY were measured using an ELISA kit (Shanghai Yeyuan Biotechnology Company, China) and with an ELISA Reader (Thermo Fisher, Varioskan Flash, USA) following the manufacturers’ instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... BCA protein assay kit (ThermoFisher Pierce BCA Protein Assay) was used to determine the protein concentration ...
-
bioRxiv - Genetics 2020Quote: ... protein quantification using BCA Protein Assay Kit (Thermo Fisher) was done ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were quantified using BSA Protein Assay Kit (ThermoFisher). Equal amounts of protein were boiled with 6X loading buffer (375mM Tris HCL ...
-
bioRxiv - Genomics 2020Quote: ... We also validated protein expression and inducibility of the KRABINER rescue transgenes via western blot (mouse anti-myc antibody ThermoFisher #MA1-21316 ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 μL reactions containing 10 μL Myc-xCENP-C truncations in interphase CENP-C-depleted extract were added to 10 μL Protein A Dynabeads (Invitrogen) coupled to 2.5 μg mouse anti-Myc antibody ...
-
bioRxiv - Molecular Biology 2024Quote: The transfection of a mixture of specific siRNA against c-Myc protein (exon 2 and exon 3, IDs s9129 and s9130, respectively; Ambion) and DOT1L protein (IDs s39011 ...
-
bioRxiv - Immunology 2021Quote: ... Protein secretion levels in culture supernatant were quantified via ELISA for human IgG (Invitrogen, 50-112-8849) and human BAFF (R&D Systems ...
-
bioRxiv - Microbiology 2021Quote: ... Protein levels of IL-18 from intestinal biopsies were measured by ELISA (BMS618-3, ThermoFisher, Waltham, MA). Assays were performed according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: Recombinant human CD81 protein (R &D Systems) was coated (4µg/ml) on ELISA plate (Thermo Fisher Scientific) and incubated overnight at 40C ...
-
bioRxiv - Biochemistry 2020Quote: ... The expression of the recombinant protein was measured by ELISA using anti‐His tag monoclonal antibody (Invitrogen) to capture and biotinylated anti‐ANG1 antibody for detection (R&D System) ...
-
bioRxiv - Neuroscience 2021Quote: ... were weighted and homogenized in ice-cold N-PER Neuronal Protein Extraction Reagent (Thermofisher # 87792) with protease and phosphatase inhibitors in 1mL per 100mg ratio ...
-
bioRxiv - Biophysics 2022Quote: ... The protein stock was labelled with Alexa 647-N-Hydroxysuccinimide (Alexa 647-NHS, Thermo Fisher) at sub-stoichiometric ratios yielding a labelling efficiency of <5% ...
-
bioRxiv - Biophysics 2020Quote: ... The concentration of the N protein was determined using the Bradford Assay (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: Frozen tissues were homogenized in ice-cold N-PER Neuronal Protein Extraction Reagent (Thermo Fisher) containing protease inhibitor and phosphatase inhibitor cocktail (Cat# PPC1010 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative PCR of MYCN expression was performed on 1:10 of cDNA using the SYBR Green PCR master mix (Thermo Fisher Scientific Inc.) with MYCN forward (5’ GAGCGATTCAGATGATGAAG 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... and rat anti-glial fibrillary acidic protein (GFAP) Mab (ThermoFisher Scientific #13-0300, 1:500). Sections were then washed in PBST and incubated with fluorophore-conjugated secondary antibodies ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... a rat G-protein (Gα15i2) and a photoprotein (mt-apoclytin-II) using Lipofectamine 2000 (Invitrogen). Control cells were only transfected with plasmids for the rat G-protein and the photoprotein (without receptor plasmids) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hydroxybenzotriazole (HOBt) and O-(benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate (HBTU) were purchased from Fisher Scientific. Trifluoroacetic acid (TFA ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were measured using the Bio-Rad Protein Assay Kit or BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts (25 μg or 10 μg ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein concentration was quantified using the “Protein Quantification BCA Assay” kit (Pierce BCA Protein Assay Kit, Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... Qubit protein assay kit (Invitrogen) was used to obtain protein concentration ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from WT and MafAS64F/+ islets (n=4 for males, n=5 for females) using the RNAqueous total RNA isolation kit (Ambion; Thermo Fisher), and then analyzed on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Systems Biology 2020Quote: ... Peptides from each individual case (n=400) and the GIS pooled standard (n=100) were labeled using the TMT 10-plex kit (ThermoFisher 90406). In each batch ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples (N=400) and the pooled global internal standards (GIS) (N=100) were labelled using the TMT 10-plex kit (ThermoFisher 90406) as previously described in (Johnson et al. ...
-
bioRxiv - Genomics 2022Quote: ... Peptides from each individual (n=400) and the GIS pooled standard (n=100) were labeled using the TMT 10-plex kit (ThermoFisher 90406). Peptide eluents were separated on a self-packed C18 (1.9 μm ...