Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Mouse Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The Aβ42 (ELISA kit, # KMB3441, Invitrogen, Carlsbad, CA, USA) and CRP (Quantikine ELISA kit ...
-
bioRxiv - Microbiology 2020Quote: ... Total IgE was measured by ELISA using kit (Invitrogen) and performed according to manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... IFN beta human ELISA kit (Thermo Fisher Scientific; 414101) was used to quantify IFNB1 ...
-
bioRxiv - Microbiology 2022Quote: All commercially available ELISA kits were purchased from Invitrogen Thermo Fisher Scientific and the assays were performed according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Mcpt6 ELISA kit (Thermo Fisher Scientific, MA, USA), respectively.
-
bioRxiv - Neuroscience 2022Quote: We used commercially available ELISA kits (Invitrogen-ThermoFisher Scientific) to quantify soluble and insoluble levels of Aβ ...
-
bioRxiv - Neuroscience 2022Quote: We used commercially available ELISA kits (Invitrogen-ThermoFisher Scientific) to quantify soluble and insoluble levels of Aβ ...
-
bioRxiv - Pathology 2023Quote: We used commercially available ELISA kits (Invitrogen-ThermoFisher Scientific) to quantify levels of soluble and insoluble Aβ42 and insoluble Aβ40 ...
-
bioRxiv - Pathology 2023Quote: We used commercially available ELISA kits (Invitrogen-ThermoFisher Scientific) to quantify levels of soluble and insoluble Aβ42 and insoluble Aβ40 ...
-
bioRxiv - Immunology 2022Quote: ... Human IFN gamma Uncoated ELISA kit (88-7316, Invitrogen) and IL-2 Human Uncoated ELISA Kit (88-7025 ...
-
bioRxiv - Biochemistry 2023Quote: Solid-phase sandwich ELISA kits were purchased from Invitrogen. The ELISA experiments were performed according to the kit instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Human IL-6 ELISA kit was from Life Technologies. FAN1KO HD patient fibroblasts were generated and received from Synthego ...
-
bioRxiv - Molecular Biology 2020Quote: ... The washing procedure was repeated and 50 μL of the buffer containing substrate (1-Step Ultra TMB ELISA Substrate, Thermo Scientific) was added to develop the colorimetric reaction for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The washing procedure was repeated and 50 μL of the buffer containing substrate (1-Step Ultra TMB ELISA Substrate, Thermo Scientific) was added to develop the colorimetric reaction for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... 1 µg of biotinylated S1 protein (Genscripts) was used to saturate the binding sites on 1 µl of FluoroSphere neutravidin beads (Thermo Fisher) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... yoelii AMA-1 or MSP-119 proteins in sodium bicarbonate buffer were used to coat high binding Immunlon HBX plates (Thermo Scientific) at 4°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Levels of secreted amyloid-beta 1-42 were quantified using a sandwich ELISA kit (Invitrogen, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was then diluted 1:5 in 1x Assay buffer and processed according to the kit instructions (DNA Damage Competitive ELISA Kit, Invitrogen). The initial DNA concentration used in the assay was optimized to ensure the resulting values fall within the optimum range of kit detection limits (between Std3 and Std6) ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane containing the biotin alkyne labeled proteins was incubated in a solution containing 1% BSA with streptavadin-HRP (Invitrogen) for subsequent visualization.
-
bioRxiv - Plant Biology 2019Quote: Leaf material (pellet) kept for starch quantification was suspended in 1 mL of hydrochloric acid 1.1 % (Fisher Scientific; Hampton, New Hampshire, USA), vortexed and placed in a water bath at 90 °C for 30 min to extract and hydrolyze starch into glucose molecules ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibody binding was visualized using species specific fluorescent secondary antibodies conjugated to Alexa Fluor goat anti-mouse 488 (1:1000; Molecular Probes). Sections were mounted using fluorescent mounting medium (DAKO).
-
bioRxiv - Molecular Biology 2021Quote: ... Interactions were visualized by the incubation of tetramethylrhodamine (TRITC) labelled secondary goat anti-mouse IgG antibodies (Fc specific; 1:1000 dilution in binding buffer; Life Technologies) and goat anti-Human IgG (Fc specific)-Cy3 (1:1000 dilution in binding buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... and labeled on ice with 1:250 dilution of secondary antibodies for binding (anti-mouse 488, ThermoFisher A11059 or anti-human 647, ThermoFisher A21445) and expression (anti-chicken 647 ...
-
bioRxiv - Immunology 2023Quote: ... Antibody binding was detected either with mouse-anti-human or rabbit IgG-PE (Invitrogen) and detected using the FACS Symphony (BD) ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysates were cleared by centrifugation and protein-containing supernatants were collected into fresh tubes and quantified with the Pierce BCA protein assay kit (Thermo Scientific) using a two-fold dilution curve of BSA (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... monoclonal mouse anti-S6 ribosomal protein (MA515123, Thermo Fisher Scientific; 1:100), polyclonal rabbit anti-RPL24 (PA530157 ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug/mL Laminin mouse protein (Thermo Fisher Scientific; Cat. No. 23017015), 10 nM ROCK inhibitor ...
-
bioRxiv - Bioengineering 2021Quote: ... and 50 µL of binding buffer containing 5 µg/mL Streptavidin Poly-HRP (ThermoFisher Scientific 21140) was added to each well and incubated for 30 minutes with shaking at 500 RPM ...
-
bioRxiv - Immunology 2019Quote: ... 1× protein transport inhibitor cocktail (PTIC) containing Brefeldin A/Monensin (eBioscience, Thermo Fisher Scientific) with or without anti-CD107a (eBio1D4B ...
-
bioRxiv - Molecular Biology 2021Quote: ... The concentration of IL-2 in 2x diluted supernatants was measured using an IL-2 mouse ELISA kit (Thermo Fisher Scientific) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The IL-6 levels in plasma were analyzed using a Mouse IL-6 Uncoated ELISA kit (#88-7064, Invitrogen, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: EV-depleted media/ACSF samples (50 µL volume) were used for measurement of Tau concentration by a mouse-specific total Tau ELISA kit (KMB7011, Thermo Scientific) or pS199 Tau ELISA kit (KMB7041 ...
-
bioRxiv - Neuroscience 2024Quote: Determination of sIL-6R was performed in the FN of NL and 21 dpi of aged WT and GFAP-IL6Tg (n=3-6/experimental group) using a precoated mouse ELISA kit (EMIL6RA, Fisher Scientific) and following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The amount of TNF-α and IL-6 in culture supernatants was quantified using commercial mouse ELISA kits (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... Tandem Mass Tag 6-plex labelling of eluted RNA-binding proteins was performed using the TMTsixplex Isobaric Mass Tagging Kit (Thermo Scientific; Rockford, IL) and analysis by liquid chromatography tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Biophysics 2021Quote: ... The SNAP-tag allows for covalent binding of O6-benzylguanine (BG) to the protein.[63] Protein expression was performed in Escherichia coli BL21(DE3) pRARE (Invitrogen) under T7 promoter with 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Immunology 2022Quote: ... ELISA was developed with 50uL TMB (1-Step Ultra TMB-ELISA, Thermo Fisher, Waltham, MA, USA) for 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... signals of both ELISAs were visualized using 1-step Ultra TMB ELISA substrate (Fisher Scientific 34028), an incubation period at RT and addition of 2 M sulfuric acid as the stop reagent ...
-
bioRxiv - Molecular Biology 2023Quote: ... Wells were washed 3 times with TBS-T and phage binding was detected by addition of 20 µl SuperSignal™ ELISA Pico Chemiluminescent Substrate (Thermo-Fisher Scientific) and read on an Envision multilabel plate reader (Perkin-Elmer) ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria from day two plates were resuspended in PBS and adjusted to an OD 600 nm of 0.5 to coat high binding ELISA plates (Nunc-Immuno™, ThermoScientific). After incubation overnight at 4ºC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were analyzed in duplicates using Monkey IL6 ELISA and Monkey TNFα Total ELISA kits (ThermoFisher, Waltham, MA) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Total tau content was quantified in brain extracts by ELISA (Human Tau (total) ELISA kit (#KHB0041, Invitrogen, UK), see supplementary methods ...
-
bioRxiv - Pathology 2024Quote: ... and C-X-C Motif Chemokine Ligand 1 (CXCL1) levels were measured in liver protein lysates and EDTA-plasma by enzyme-linked immunosorbent assay (ELISA) (ThermoFisher) according to the manufacturer’s instructions ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... and 1-Step Ultra TMB-ELISA (ThermoFisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... 1-Step Ultra TMB-ELISA Substrate Solution (ThermoFisher) was added and incubated at room temperature for either 15 minutes (V3 peptides ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 Step Ultra-ELISA TMB substrate (ThermoFisher).
-
bioRxiv - Cancer Biology 2024Quote: ... Substrate (1-Step Ultra TMB-ELISA; ThermoFisher Scientific) was added for 10 min and reactions were stopped with the addition of 1M sulfuric acid (final) ...
-
bioRxiv - Immunology 2024Quote: ... 1-Step Ultra TMB-ELISA substrate solution (ThermoFisher) was added to develop for 5 minutes and quenched with 2N sulfuric acid (VWR) ...
-
bioRxiv - Neuroscience 2024Quote: ... IBA-1 (ionized calcium-binding adapter molecule 1; antibody PA5-21274, Invitrogen; 1:150) and astrocytes (anti-S100 beta antibody ...