Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Mono 2 Carboxymethyl Hexyl Phthalate Cp 95% 13C4 99% Dehp Metabolite Iv 100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the supernatant was replaced with 1.5 ml freshly made secondary dissociation buffer (10xTrypLE with 1 mg/ml collagenase IV, both from Gibco). Samples were placed in rotating incubator for 5 minutes at 37°C then passed through a 20G needle with a 1 ml syringe and placed back in rotating incubator (37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... For CD26+ and Sca1+ fibroblasts dermis was separated from the skin of P2 or P3 mice in 1 mg/ml of dispase for 1 h at 37 °C and digested in 2.5 mg/ml of collagenase IV (Gibco) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... tissue was digested for a further 24 h with 0.5 mg/mL collagenase type IV (CLS-4, Lorne Laboratories) and 1 mg/mL dispase II (17105041, Invitrogen) at 37 °C and 5% CO2 with constant agitation [38].
-
bioRxiv - Developmental Biology 2023Quote: ... Lens apoptosis was determined in the same SAG and control DMSO embryos as heart eye measurements were made by staining with 5 μg/ml Lysotracker Red DND 99 (Invitrogen) for 30 min in the dark as described previously (Ma et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... at 100 µg/mL in complete DMEM medium for 4 h and treated with LysoTracker Red DND-99 (Invitrogen #L7528) for 15 min and subsequently imaged on a Nikon CSU-W1 SoRa microscope ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 ug of total RNA was used for cDNA synthesis with SuperScript IV (Thermo Fisher Scientific). The real-time qPCR reaction was assembled using the PowerUp™ SYBR® Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2019Quote: ... 2 μg RNA were reverse transcribed using the SuperScript IV Reverse Transcriptase kit (ThermoFisher Scientific, 18091200)) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was generated from 2 µg of total RNA by using Superscript IV vilo (#11766050, Invitrogen) and primer 2 (Table S2 ...
-
bioRxiv - Plant Biology 2023Quote: ... CP-R: 5’GGGGACCACTTTGTACAAGAAAGCTGGG TCCTGCACAGAACCTACTCC3’) and subcloned into the Gateway entry vector pDONR 221 (Invitrogen) by BP reaction and finally recombined into the destination vector pEarleyGate 201-nYFP and pEarleyGate 202-cYFP vector (Dai et al. ...
-
bioRxiv - Molecular Biology 2022Quote: 3 μl of purified ribosome sample was applied to Quantifoil 300 mesh R2/2 grids with an ultrathin 2 nm carbon layer and frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific) at 15 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Cryo-EM samples were prepared on Quantifoil copper 300-mesh 2/2 holey carbon grids and were plunge-frozen in a Vitrobot Mark IV (Thermo Fisher Scientific) with a chamber temperature of 4°C and a humidity set to 95% ...
-
bioRxiv - Cancer Biology 2021Quote: ... The pooled MTBE androgen extract was dried under nitrogen (5 psi) using Reacti-Vap™ Evaporators (TS 18826, Thermo Fisher Scientific, Waltham, MA) in a fume hood at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... were used to bind to presynaptic axonal regions and anti-post synaptic density protein 95 (PSD-95) antibodies (Invitrogen, Carlsbad ...
-
bioRxiv - Microbiology 2020Quote: ... and Superscript IV (Invitrogen). Finally ...
-
bioRxiv - Cancer Biology 2021Quote: ... SuperScript IV (ThermoFisher Scientific) was used to synthesize cDNA ...
-
bioRxiv - Neuroscience 2020Quote: SuperScript IV VILO (Thermofisher) was used to reverse transcribe RNA from input and IP samples (concentrations adjusted) ...
-
bioRxiv - Microbiology 2022Quote: ... Immulon IV ELISA (Nunc) plates were coated with 10 μg/mL of fecal antigen in Coat Buffer (0.05M Na2CO3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... SuperScript IV (Thermo Fisher), Revert Aid (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Superscript IV (Invitrogen) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... SuperScript IV (ThermoFisher #18090050) or Induro (NEB #M0681L ...
-
bioRxiv - Cell Biology 2019Quote: ... mono-reactive NHS ester and purified using Zeba Spin desalting columns (Thermo Scientific) according to the manufacturers’ instructions.
-
bioRxiv - Microbiology 2023Quote: Primers were pre-annealed to the RNA by heating for 2 minutes at 95 °C prior to an RT step carried out using SuperScript III Reverse Transcriptase (Invitrogen) as described previously (15) ...
-
bioRxiv - Immunology 2020Quote: ... then incubated for 1 hour with RPMI medium containing 0.2 mg/ml Collagenase IV (GIBCO) and 0.1 mg/ml DNase I (Roche) ...
-
bioRxiv - Pathology 2022Quote: Tissue was digested in culture medium supplemented with 0.6 mg/ml collagenase IV (17104019, Gibco) and 0.01 mg/ml DNase I (11284932001 ...
-
bioRxiv - Neuroscience 2020Quote: ... iPSC colonies were detached using 1 mg/ml collagenase (Type IV, Thermo Fisher Scientific, 17104019) in Gibco KnockOut DMEM/F-12 medium (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... after it was transferred to a collagenase IV solution (1 mg/ml in DMEM, Gibco) for 1 hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... followed by incubation in digestion buffer (100U/mL Collagenase Type IV (Gibco, Cat. No. 17104019) prepared in DMEM (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... The digestion media contained collagenase IV and dispase II (1 mg/ml each; Thermo Fisher) in DMEM media ...
-
bioRxiv - Neuroscience 2023Quote: ... Stable clones were routinely passaged onto matrigel using 1 mg/ml collagenase type IV (Invitrogen) and addition of 10 µM Y-27632 (Ascent Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 1 mg mL−1 was vitrified using a Mark IV Vitrobot (Thermofisher). Prior to sample vitrification ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 4 mg ml-1 collagenase IV (Thermo Fisher Scientific, Catalog no. 17104-019) and DNAse I (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Cells were routinely passaged as clumps using 1mg/ml Collagenase IV (Gibco-Thermo Fisher Scientific). For experiments requiring single-cell suspension ...
-
bioRxiv - Genomics 2023Quote: ... Cells were routinely passaged as clumps using 1mg/ml Collagenase IV (Gibco-Thermo Fisher Scientific). For experiments requiring single-cell suspension ...
-
bioRxiv - Molecular Biology 2021Quote: ... the ViewRNA Cell Plus (Thermo Fisher Scientific, 88-19000-99) kit was used according to the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Neuroscience 2019Quote: ... and LysoTracker Red DND-99 (Catalog no. L7528, ThermoFisher Scientific) staining was performed as per the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2020Quote: ... and incubated with 100 nM LysoTracker Red DND-99 (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... at 100 nM and LysoTracker Red DND-99 (Thermo Fisher) at 50 nM after 30 minutes of incubation ...
-
bioRxiv - Microbiology 2021Quote: ... L-lactic acid sodium (99%, extra pure, Acros Organics 439220100) at VFA concentrations of 0.1 and 1 g/L.
-
bioRxiv - Bioengineering 2021Quote: ... N,N-dimethylformamide (DMF) 99% (Acros Organics cat. no. 423640010), 1x phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μM final concentration of LysoTracker Red DND-99 (ThermoFisher) was added to each well and incubated for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μM final concentration of LysoTracker Red DND-99 (ThermoFisher) was added to each well and incubated for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μM LysoTracker Red DND-99 (L7528, Thermo Fisher Scientific) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissected testes were incubated in Lysotracker RedDND-99 (ThermoFisher Scientific) in PBS (1:1000 dilution ...
-
bioRxiv - Physiology 2021Quote: ... then stained with Lysotracker Red DND-99 (Thermofisher, 1:2000) with Hoechst 33342 (1mg/ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Sodium chloride (NaCl 99% pure) was procured from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysotracker Red-DND-99 (L7528) was purchased from Thermo scientific and used at 75nM ...
-
bioRxiv - Immunology 2021Quote: ... LysoTracker Red DND-99 reagent (Molecular Probes, diluted 1:2000) was added to cultures 2 h before the end of the indicated time points.
-
bioRxiv - Bioengineering 2022Quote: ... were dissolved in anhydrous dimethyl sulfoxide (DMSO) (>99%, Fisher Scientific) under argon at 45°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and lysosome LysoTracker™ Red DND-99 staining (Invitrogen, L7528). All microscopy quantification was done using ImageJ.
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with LysoTracker Red DND-99 (Invitrogen, L7528) for 30 min ...