Labshake search
Citations for Thermo Fisher :
401 - 450 of 6809 citations for Human IL 17 Receptor since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... APC-conjugated anti-CD115 (Invitrogen, clone AFS98, #17-1152-82, 1/100), BV650-conjugated anti-Gr-1 (Biolegend ...
-
bioRxiv - Developmental Biology 2022Quote: ... APC anti-mouse CD31 (PECAM-1) (Thermo Fisher Scientific, 17-0311-82), PE Rat IgG2α (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then stained with anti-CD3-APC (Invitrogen, #17-0032-82), anti-CD4-PerCP-Cy5.5 (Biolegend ...
-
bioRxiv - Physiology 2021Quote: ... 17] in Minimal Essential Media with Earl’s salts (Gibco; Gaithersburg, MD USA) plus 10% FBS and 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Embryos were fixed with 17% formaldehyde/heptane (ThermoFisher Scientific, Waltham, MA, USA) for 20 min followed by methanol or ethanol devitellinization ...
-
bioRxiv - Cell Biology 2021Quote: ... Embryos were fixed with 17% formaldehyde/heptane (ThermoFisher Scientific, Waltham, MA, USA) for 20 min followed by methanol devitellinization ...
-
bioRxiv - Microbiology 2020Quote: ... and premixed Difco™ ISP4 dehydrated medium (Fisher Scientific, #DF0772-17-7)) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293T/17 cells were co-transfected using Lipofectamine 2000 (Life Technologies) with MLV Gag-Pol packaging construct and the MLV transfer vector encoding a luciferase gene reporter either by itself (MLV-control ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies used in FACS including anti-CD11b APC (17-0118-42, Invitrogen), anti-CD33 PE (303404 ...
-
bioRxiv - Pathology 2023Quote: ... or the APC isotype control (Thermo Scientific, #17-4714-42, 5 μL) was added to their respective samples tubes at concentrations recommended by the manufacturer ...
-
bioRxiv - Bioengineering 2023Quote: ... HEK293T/17 cells were cultured in Dulbecco’s Minimum Essential Medium (DMEM, ThermoFisher) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Tbet anti-mouse APC (Thermo Fisher Scientific, Catalog no. 17-5825-82), IL-17A anti-mouse Alexa Fluor 488 (BioLegend ...
-
bioRxiv - Genomics 2024Quote: PA was dissolved in HPLC grade ethanol (Fisher Scientific, 64-17-5) to a final concentration of 5mg/mL to create a stock solution ...
-
bioRxiv - Cell Biology 2024Quote: ... and CD326(aka EpCAM)-APC (ThermoFisher, clone: G8.8, cat# 17-5791-82); DAPI was used to gate out dead cells ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T-17 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Synthetic Biology 2024Quote: ... into a 96-well round bottom plate (Fisher Scientific #08-772-17). This plate was then analyzed with a CytoFLEX flow cytometer.
-
bioRxiv - Neuroscience 2024Quote: ... Myelin was removed by 24% Percoll (Fisher Scientific, cat# 17-0891-01) and PBS density gradient centrifugation for 20 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Physiology 2020Quote: ... the anti-transferrin receptor mouse monoclonal antibody (TransR, 1:1000, Thermo Fisher Scientific), and the anti-glyceraldehyde 3-phosphate dehydrogenase mouse monoclonal antibody (GAPDH ...
-
bioRxiv - Microbiology 2020Quote: ... Toll-like Receptor (TLR) 4 (Thermo Fisher Scientific, Waltham, MA, USA, 1:2000), TLR7 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... conditioned media enriched in individual receptors was prepared in Expi293F cells (Thermo Fisher), transiently transfected with receptors expressed as ectodomains fused to a human Fc (IgG1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membrane fraction’s protein content was normalized by using anti-transferrin receptor antibody (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... appropriate primary antibody receptor targeting1:2,000 mouse PSD-95 (cat # MA1-046,Thermofisher), 1:200 rabbit GluA1 (cat # AB1504 ...
-
bioRxiv - Immunology 2022Quote: ... Selection for the KIR-CD3ζ receptor was performed by increasing the puromycin (Invitrogen) concentration to 1.0 µg/ml over 3-4 weeks and then maintaining at 0.5 µg/ml ...
-
bioRxiv - Immunology 2023Quote: ... THP-1 receptor cells were stained with CellTrace Violet (Thermo Fisher Scientific #C34557) at a final concentration of 1 μM in PBS for 20 minutes ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... N-methyl-D-aspartate receptor 1 (NMDAR1, rabbit, 1:1000, Invitrogen PA5-34599), N-methyl-D-aspartate receptor 2B (NMDAR2B ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Immunology 2022Quote: ... either alone or with anti-IL-1β or anti-IL-6 neutralizing antibodies (Thermofisher, Waltham, MA), and ensuing protein lysates blotted for phosphorylated STAT-3 (pSTAT3) ...
-
bioRxiv - Immunology 2021Quote: ... UltraComp eBeads™ and mouse IL-5/IL-13 ELISA kits were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasma IL-6 levels were measured by mouse IL-6 ELISA kit (ThermoFisher Scientific, Waltham, MA).
-
bioRxiv - Immunology 2020Quote: ... IL-2 was measured from culture supernatants using a mouse IL-2 ELISA kit (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... and IL-12 levels were determined using the IL-12 p70 Mouse Uncoated ELISA Kit (Invitrogen). Isolated tumors were snap-frozen on dry ice ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 measurement was performed using IL-6 Mouse Uncoated ELISA Kit (88-7064-22; Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... IFN-γ IL-4 and IL-6 were measured by Mouse Uncoated ELISA Kit (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), and forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL-23p19-AF488 (fc23cpg, Invitrogen); anti-IL-1β-APC (NJTEN3 ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-6 (20 ng/mL, ThermoFisher). To generate human induced pluripotent stem cells (iPSCs) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100ng/ml IL-4 (Gibco, USA) for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... caveolin-2 (Thermo Fisher, Rockford, IL), and STIM1/CRACR2A (CRAC regulator 2A ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse IL-1β (Invitrogen, # 701304); anti-mouse Cleaved IL-1β (Cell Signaling Technology ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylbenzidine (ThermoFisher Scientific, Rockford, IL, USA) and read at 450 nm according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Systems Biology 2022Quote: ... and IL-8 (Invitrogen, catalog # KHC0081) levels in the media samples were conducted according to the manufacturer’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in duplicate by ThermoFisher (Life Technologies Corporation, Chicago, IL 60693) using Z’Lyte (76) ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-8 (ThermoFisher Scientific, catalog # PHC0884), and ChaCha (Anaspec ...