Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... washed platelets were stained with Fluo-4 AM (5 μM, Thermo Fisher Scientific) for 30 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... which included 5 µL 4× Taqman Fast Advanced Master Mix (Thermo Fisher Scientific), 0.4 µL of each primer (tat 2.0 and rev ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were loaded with 5 μM of Fluo-4-AM (Thermo Fisher Scientific) for 50 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 for 4 minutes and resuspended in E8 medium (Thermo Fisher Scientific) and 10 μM Y-27632 Rho-kinase inhibitor (ROCKi ...
-
bioRxiv - Bioengineering 2023Quote: ... calcium imaging was performed using 5 μM Fluo-4-AM (ThermoFisher, F14201, US) in Krebs-Ringer’s solution containing NaCl 119 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: Protein (5 µg) was loaded on NuPAGE 4–12% Bis-Tris gels (ThermoFisher), separated by electrophoresis and transferred to Hybond PVDF membrane (GE Healthcare) ...
-
bioRxiv - Physiology 2024Quote: ... cells were loaded with 5 µM of Fluo-4-AM (Thermo Fisher Scientific) or for 50 min at room temperature in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4-5 mg/mL of Ellman’s reagent (Thermo Fisher Scientific, Waltham, MA) were dissolved in a sodium phosphate buffer (0.1M NaH2PO4 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were split every 4-5 days with TrypLE Select Enzyme (Life Technologies) as previously described ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2024Quote: ... blocked for 1h at RT in blocking solution (5% rabbit serum (10510, ThermoFisher) and 1% BSA (A4503 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the nuclei were stained in 0.05 M PBS solution containing 1 mg/ml polyvinylpyrrolidone and 0.5 μl/ml 2-(4-amidinophenyl)-1H-indole-6-carboxamidine (DAPI; Thermo Fisher Scientific, Waltham, MA, USA). The coverslips were rinsed in distilled water for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and ran on QuantStudioTM 6 Flex Real-Time PCR System using QuantStudioTM 6 and 7 Flex Real-Time PCR software v1.0 (Applied Biosystems). Relative gene expression levels were quantified using β-actin or human TBP as housekeeping genes ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Biochemistry 2021Quote: ... Transfection of MCF-7 and MCF-7/ADR cells was performed with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and single cell suspensions stained with 7-aminoactinomycin D (7-AAD; ThermoFisher Scientific, Waltham, Massachusetts) were analyzed on an LSR II flow cytometer (Becton Dickinson).
-
bioRxiv - Immunology 2020Quote: ... Cell death was assessed by 7-aminoactinomycin D (7-AAD, Affymetrix eBioscience, San Diego, CA) staining and flow-cytometry (FACSCantoII™ ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were centrifuged at 14,000g for 5 minutes at 4°C and electrophoresed on NuPAGE™ 4-12% Bis-Tris Polyacrylamide gels (Thermo Fisher) with NuPAGE™ MOPS running buffer (Thermo Fisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... NaHCO3 and 150 μL acetone containing 4 mg/mL 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (L-FDAA, Thermo Scientific) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... The next day the membrane was washed three times with 5% milk and incubated for 4 hours at 4°C in an anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: For BODIPY 494/503 (4,4-Difluoro-1,3,5,7,8-Pentamethyl-4-Bora-3a,4a-Diaza-s-Indacene, Thermo Fisher Scientific, D3922) staining ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene (BODIPY 493/503; 10 μM; Thermo Fisher Scientific). To determine mitochondrial mass ...
-
bioRxiv - Immunology 2024Quote: 50 000 enriched CD11b+ LCs were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Immunology 2022Quote: 90μL of paraformaldehyde fixed cells was incubated with 5 x 10-7 M DAPI and 1:100 Vybrant™ DiD Cell-Labeling Solution (Invitrogen) at 37C for 20 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Neurospheres were passaged by centrifuging 5 min at 1,000 rpm and incubating for 7 min in Accutase (Gibco® A11105-01) before mechanically dissociating the spheres into single-cell suspension.
-
bioRxiv - Immunology 2021Quote: ... a T-cell proliferation assay was performed by incubating collected mice spleen cells for 7 min at RT with 5 μM Carboxyfluorescein succinimidyl ester (CFSE) (Life Technologies), staining was quenched with FCS and splenocytes cultured at 106 cells/well in 96-well plates for 5 days at 37°C in 5% CO2 with 3 μg/ml of rSp antigen ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Immunology 2022Quote: 22-(N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Amino)-23,24-Bisnor-5-Cholen-3β-Ol-cholesterol (22-NBD-cholesterol) (N1148) and 7-NBD-PE (N360) were obtained from Thermo Fisher and dissolved in ethanol at 1 mM ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: COS-7 cells were grown at 37°C with 5% CO2 in complete Dulbecco’s Modified Eagle’s Medium (DMEM) (Thermo Fisher Scientific, USA) containing 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: 7 μM Aβ40 was incubated with varying stoichiometries of claramine and 5% PEG (50% w/w 10 kDa, Thermo Fisher Scientific) in the presence of 20 mM ThT (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: Real-time PCR was performed by standard TaqMan Assay on either the QuantStudio 7 or Quantstudio 5 Real-Time PCR platform (Applied Biosystems). Briefly ...
-
Machine Learning Ensemble Directed Engineering of Genetically Encoded Fluorescent Calcium IndicatorsbioRxiv - Bioengineering 2023Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... The medium was changed every day and cells were passaged at 70%-80% confluency every 5-7 days using PBSCa-/Mg- (Life Technologies; Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: qPCR was performed with 2.5 ng of DNA in triplicates using PowerSYBR Green PCR master mix at Quant Studio 7 qPCR machine (both Applied Biosystems) according to the manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... the samples were stained with 80 μL CellEvent Caspase 3/7 Green detection Reagent 2 µM in PBS with 5% FBS (Invitrogen, C10423) and then incubated for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: Primary cortical neurons were maintained for 7 days (DIV 7) before EV treatment at 37°C in 5% CO2 and cultured in serum-free Neurobasal medium (Life Technologies) supplemented with 1.2% GlutaMAX-I (Life Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... 60 °C/15 sec and 72°C/30 sec with a final extension at 72 °C for 5 min using the ViiA 7 Real-Time PCR System equipment (Thermo Fischer/Applied Biosystems). The gene copy number was calculated based on the 2-ΔΔCT method and the gapdh gene was used as endogenous control (Table S3).
-
bioRxiv - Bioengineering 2024Quote: ... The media was replaced by 7 ml MEMα with 5% fetal bovine serum and G418 antibiotic (Invitrogen, California, United States, cat. # ). The cells were counted every 24 hours and the culture media was frozen in liquid nitrogen for further analysis.
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...