Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 8 Bromo 5 6 difluoro 2 methylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4′,6-diamidino-2-phenylindole (DAPI) was acquired from Invitrogen, Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) or propidium iodide (PI ...
-
bioRxiv - Microbiology 2021Quote: ... BODIPY 493/503 (4,4-Difluoro-1,3,5,7,8-Pentamethyl-4-Bora-3a,4a-Diaza-s-Indacene lipid stain was from Molecular Probes (Invitrogen/ Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged every 5 or 6 days using Versene (Gibco, A4239101). Clinical hESCs were tested weekly for mycoplasma contamination using a Myco-detection Kit (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 Bcl6 and 6 Smyd2 KO livers using TRIzol reagent (Invitrogen #15596026) followed by purification using the RNeasy Mini kit (Qiagen #74014) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... С6 and CHO/5-HT2C were maintained in the F12 medium (Invitrogen). In all cases ...
-
bioRxiv - Bioengineering 2024Quote: ... Coupling 5-(and 6)-Carboxytetramethylrhodamine (TAMRA) mixed isomers (Thermo Scientific, Waltham, MA) and Fmoc-8-amino-3,6-dioxaoctanoic acid (Fmoc-PEG2-OH ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Cell Biology 2021Quote: ... THP-1 cells (1.5×105 cells/mL) were labeled with a fluorescent dye 2’,7’-bis(carboxyethyl)-5 (6)-carboxyfluorescein-AM (Thermo Fisher Scientific B1150; 1 mg/mL) in serum-free RPMI medium (Thermo Fisher Scientific 11875093 ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclear stain: 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI, blue; 2 ng ml−1; Molecular Probes, USA). Sections were cover-slipped using ProLong Gold anti-fade reagent (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Cell nuclei were stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml; Molecular Probes). Stained sections were imaged using epifluorescence and deconvolution epifluorescence microscopy on an Olympus IX83 ...
-
bioRxiv - Biophysics 2021Quote: ... Then the enzyme-inhibitor mixture was placed in a 6–8 kDa MWCO dialysis membrane (Fisher Scientific, Canada) and dialyzed against 2 L of 50 mM Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: ... hiPSC-IMR90-1 cells were cultured on a Matrigel-coated 6-well plate with Essential 8 medium (Gibco). The medium was changed daily ...
-
bioRxiv - Cell Biology 2020Quote: ... 1.8 mM CaCl2, 6 mM NaHCO3, 5.5 mM D-glucose, 25 mM HEPES, pH 7.4 supplemented with Gibco MEM Amino Acids and MEM Non-Essential Amino Acids solution ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were sacrificed 6-8 days after the last CDSD session and RNA was extracted with TriReagent (Ambion). Sequencing libraries were prepared with ScriptSeq v2 RNA-seq library preparation kit (Epicentre ...
-
bioRxiv - Developmental Biology 2023Quote: ... were isolated from embryos incubated for between 6 (E6.0) and 8 (E8.0) days and maintained in chilled Leibovitz’s L-15 media (GIBCO, Invitrogen). Papillae were dissected as described previously 65 and cultured nerve-side-down on Millicell cell culture inserts (Millipore ®) ...
-
bioRxiv - Bioengineering 2024Quote: ... RC Dialysis tubing (3.5 kDa or 8 kDa molecular weight cut-off, Spectrum Spectra/Por 6, Fisher Scientific), HCl (2M ...
-
bioRxiv - Biophysics 2021Quote: ... Secondary antibodies were goat anti-mouse-Star red (Abberior, 2-0002-011-2) and goat anti-rabbit Star 580 (Abberior 2-0012-0050-8) (Life Technologies, 1:100).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 and 8 were dissociated into single cells with 0.05% Trypsin-EDTA (Invitrogen, 25300062), counted by Countstar (BioTech ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from pools of 5 to 8 mosquitoes was isolated with TRIzol (Invitrogen). Small RNAs of 19-33 nucleotides in length were purified from a 15% acrylamide/bisacrylamide (37.5:1) ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... cells were stained by BODIPY™ FL C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific #D3922) to determine the amount of lipid droplet in regular conditions ...
-
bioRxiv - Microbiology 2020Quote: ... 1.3 µL of 1 mg/mL stock of the lipophilic fluorescent dye BODIPY (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene, 493/503, Molecular Probes, ThermoFisher Scientific, USA) per sample was added to stain for neutral lipids (TAG) ...
-
bioRxiv - Developmental Biology 2022Quote: ... but the blastocysts were incubated in 10 μM 4-chloromethyl-6,8-difluoro-7-hydroxycoumarin (CMF2HC; Cell Tracker Blue, Life Technologies, Carlsbad, USA). Fluorescence intensity for GSH was measured under a Nikon scanning confocal microscope with a filter at 371 nm excitation and 464 nm emission ...
-
bioRxiv - Genetics 2020Quote: ... 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene 3-dodecanoic acid (BODIPY™ FL C12; Thermo Fisher Scientific, USA) (4 µg/mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... was cultured at 2-8×105 cells/ml in Fischer’s medium with 20% horse serum and 2 mM L-glutamine (all Gibco).
-
bioRxiv - Neuroscience 2021Quote: ... 8% SDS and 2% β-mercaptoethanol) were loaded onto 12% SDS-polyacrylamide gel and See-Plus 2 (Invitrogen, LC5925) was used as a molecular-weight marker ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Biophysics 2021Quote: ... Cell nucleus were stained with DAPI (4’,6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... All preparations were stained with 4’,6’-diamidino-2-phenylindole (DAPI, Invitrogen) for 10 minutes to label nuclei and mounted with Fluoroshield medium (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were counterstained with 4’,6’-diamidino-2-phenyliondole (DAPI; Invitrogen, D1306). Coverslips were mounted with ProLong™ Gold Antifade (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 30 min incubation with 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were briefly stained with 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) to reveal the nuclei ...
-
bioRxiv - Genomics 2020Quote: ... followed by nuclear staining with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen). Both bright field and nuclear staining images were separately taken using a Keyence BZ-X700 All-in-One microscope.
-
bioRxiv - Cancer Biology 2019Quote: ... ProLong Gold Antifade Mountant with 4′,6-diamidino-2-phenylindole (Life Technologies) was used for mounting ...