Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 8 1 Methoxyethoxy 2 6 dimethyloct 2 ene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific: D1306) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI) as directed (Invitrogen, D1306), and washed with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were stained with 4′,6′-diamidino-2-phenylindole (DAPI) (Thermo Fisher) nuclear stain diluted in PBS for 5 min with rocking ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) solution in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... then incubated with 4’-6-diamidino-2-phenylindole (DAPI; Invitrogen, Waltham, MA) for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... the fluorescent dsDNA-labelling dye 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher) was added to the culture at a concentration of 5 µg.mL−1 for 10 minutes prior imaging ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 6-diamidino-2-phenylindole were purchased from Invitrogen (Carlsbad, CA, USA). Additionally ...
-
bioRxiv - Bioengineering 2023Quote: ... Slowfade gold antifade mountant containing 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was used to rinse and seal the coverslips ...
-
bioRxiv - Genetics 2023Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Germlines were mounted in Vectashield (VectorLabs ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained with 4′,6-Diamidin-2-phenylindol (DAPI, Invitrogen, #D1306) 1:10,000 or DRAQ5 (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) was added to immunolabeled cells for 10 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, Waltham, MA, USA) was used to label all nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Neuroscience 2021Quote: A solution of 2 μM of Calcein-AM and 8 μM of ethidium homodimer-1 (both from L3224, ThermoFisher) in DPBS (14190-144 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were trypsinized and plated onto coverslips (1:2 split) or Nunc 8 well chamber slides (Thermo Fisher # 155409PK) (20-40k cells per well).
-
bioRxiv - Developmental Biology 2024Quote: ... Medium was replaced daily from 8 hpf and supplemented with 0.2 mM 1-phenyl-2-thiourea (10107703, Acros Organics) to inhibit melanogenesis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Fluorescent stains (TOTO-1 iodide; 1 μM, Life Technologies, and ethidium homodimer-2 (EthHD-2); 1 μM ...
-
bioRxiv - Immunology 2021Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020) ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... 2 μL forward primer and 2 μL reverse primer (Invitrogen; Table 1), 14.2 μL water (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020 ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1:5000 in PBS) (Molecular Probes, Eugene, OR). The TUNEL stain signal was observed under an FV300 confocal microscope (Olympus Optical Company ...
-
bioRxiv - Microbiology 2021Quote: ... with SARS-CoV-2 N-specific primers (EV Table 1) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was performed in parallel using purified SARS-CoV-2 viral RNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 6 μg of pcDNA-SARS-CoV-2-S(ΔC19) in 1 ml of Opti-MEM medium (ThermoFisher). Then ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 60 WT and MafAS64F/+ islets from at least 6 female and male mice were analyzed with the ratiometric calcium indicator fura-2-acetoxymethylester (Fura-2 AM) (Life Technologies). Islets were maintained in 5 mM glucose for 30 min prior to measuring 11 mM glucose-induced calcium oscillations and depolarization-activated calcium influx with 30 mM KCl ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Pro-inflammatory cytokine (IL-8) and (IL-6) release was determined using the IL-6 and IL-8 ELISA kit (Invitrogen) according to the manufacturer’s instructions (ThermoFisher).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2020Quote: All the in vitro transcription experiments were performed in NEB’s transcription buffer (40 mM Tris-HCl, 6 mM MgCl2, 1 mM DTT, 2 mM spermidine) with 1 mM NTPs (R1481, Thermo Scientific), 22 wt% glycerol ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Developmental Biology 2021Quote: ... samples were washed in block six times for 1 hour and incubated in secondary antibodies conjugated to fluorescent dyes diluted 1:250 in block with added 4’,6-diamidino-2-phenylindole (DAPI; 1:500 dilution of 1 mg/ml stock, Thermo Fisher) for 2 nights at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Cell Biology 2019Quote: 2 × 104 DN3a cells were added to 8 well chamber slide (Thermo Fisher Scientific) precoated with protein A ...
-
bioRxiv - Cell Biology 2022Quote: 2 × 104 DN3a cells were added to 8 well chamber slide (Thermo Fisher Scientific) precoated with PA plus Fc-E-cadherin or OP9-DL1 stromal cells and cultured for 2 or 15 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclei were detected by 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA).
-
bioRxiv - Molecular Biology 2020Quote: ... and nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) at 1:2,000 dilution at RT for 5 min ...