Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6 Octen 1 ol 3 7 dimethyl 1 formate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 6µM CellEvent Caspase-3/7 Green Detection Reagent (Thermofisher, #C10423, green fluorescence). Cancer cell lines (IGR-Heu and IGR-Pub ...
-
bioRxiv - Cell Biology 2023Quote: ... or CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific) to label apoptotic cells (Caspase-3/7 activity-positive and SytoxAADvanced-negative ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptotic cells were detected with CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (1:500) ...
-
bioRxiv - Cell Biology 2023Quote: ... the medium was switched to SFRM (DMEM/F12 [7:3] supplemented with B27 (Invitrogen), 2 mM L-glutamine).
-
bioRxiv - Immunology 2022Quote: ... The 40 mg/ml 4-HT stock solution was diluted 1:1 in Kolliphor EL (MilliporeSigma) 59.Before injection the solution was further diluted 1:3 in PBS (Gibco) and warmed to 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Immunology 2021Quote: ... were cocultured at 1:1 ratio for 6 days with anti-CD3/CD28–coated beads (Dynabeads, Life Technologies) at 1 bead ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transfected with (pRMB EDEN15) and BASU plasmids (6:1 ratio) using Lipofectamine 2000 (1:1 ratio, Life Technologies, California, USA). 40 hours post-transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... 6% native PAGE gels were prepared by first making a gel solution containing 6% acrylamide (29:1) (Fisher Scientific).15 This solution was then degassed under vacuum and mixing ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Microbiology 2021Quote: ... 6- diamidino-2-phenylindole dihydrochloride (DAPI; Thermo Fisher D1306; 1:1,000 dilution) for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...
-
bioRxiv - Neuroscience 2019Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI – D1306, Life Technologies, 1:50000) fluorescent secondary antibodies were used in all immunocytochemistry experiments where applicable ...
-
bioRxiv - Neuroscience 2019Quote: ... and monoclonal rat anti-mouse IL-6 (1:50; Invitrogen, MP5-20F3) were diluted in 3% normal donkey serum and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti phospho-tau PHF-6 (Thr231) (1:1000, Thermofisher #35-5200); mouse anti-β-Actin (1:20000 ...
-
bioRxiv - Physiology 2020Quote: ... and DAPI (4’,6-diamidino-2-phenylindole, 1 μg ml1; ThermoFisher, #D1306) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... and counterstaining with DAPI (4’, 6-diamidino-2-phenylindole, ThermoFisher, 1:10000) and phalloidin (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were passaged 1:6 once at 70% confluency using Versene (Gibco). Monocyte factories were set up following a previously reported protocol (van Wilgenburg et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6’-diamino-2-fenil-indol (1:25000) (DAPI, Life Technologies, USA) and Phalloidin (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... The 4’,6’-diamino-2-fenil-indol (DAPI) (1:2500, Life Technologies) and the Phalloidin (Alexa-488 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and DAPI (4, 6-diamidino-2-phenylindole dihydrochloride; Invitrogen, D1306, 1:500).
-
bioRxiv - Developmental Biology 2023Quote: ... with DAPI (4’, 6-Diamidino-2-Phenylindole) (Life Technologies; D1306; 1:10,000). Images were captured using a Nikon Eclipse 80i system with the NIS-Elements BR software (version 4.3 ...
-
bioRxiv - Cell Biology 2023Quote: ... The remaining material was resuspended in 6 mL sterile 1× PBS (Gibco). Samples were ultracentrifuged at 4 °C and 150,000 ˗ g for 2 h (Optima L-80 XP Ultracentrifuge with Type 70.1 Ti Fixed-Angle Titanium Rotor (Beckman Coulter) ...
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted 1:6 in DMEM/F12 media (11320033, Thermo Fisher, Waltham, USA). The iPSCs were maintained ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:6 once at 70% confluency using Versene (Gibco). Monocyte factories were set up following a previously reported protocol (van Wilgenburg et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Immunology 2021Quote: ... Anti-human TIGIT PE Cy 7 (1:50, clone MBSA43, Invitrogen, cat # 25-9500-42), Anti-human CD94 APC (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1×10^7 parasitized RBCs were incubated with 4 µM BCECF-AM (B1170, ThermoFisher) and 0.02% Pluronic F-127 (p6867 ...
-
bioRxiv - Genomics 2019Quote: ... An ArrayControl RNA Spots and Spikes kit (with spike numbers 1, 4 and 7) (Ambion) were used to monitor technical variability ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 µl of ERCC RNA spike-in mix at 10:7 dilution (Life Technologies) and barcoded reverse transcription (RT ...
-
bioRxiv - Immunology 2021Quote: ... Anti-human Amphiregulin PE Cy 7 (1:25, clone AREG559, Invitrogen, cat # 25-5370-42), Anti-mouse Nur77 APC (1:25 ...
-
bioRxiv - Bioengineering 2022Quote: ... Spheroid viability was evaluated at days 1 and 7 via Calcein AM (Invitrogen, 2 µM) and ethidium homodimer (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM DTT) in 7 kDa Slide-A-Lyzer MINI Dialysis Devices (ThermoFisher Scientific, 69562). Samples were placed in 400 ml high-salt buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Ppargc1a and Tbp (see Table 1) on a QuantStudioTM 7 Real-Time PCR System (ThermoFisher). Data were analysed using the 2-ΔΔCt method.
-
bioRxiv - Immunology 2021Quote: ... 1:100 human IgG (1 mg/ml) as FcR block and 2 % FCS using the following staining reagents: 7-AAD 1:400 (Thermo Fisher Scientific), CD19-BV786 1:20 (clone SJ25C1 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated with mouse mAb SARS-CoV-2 nucleocapsid antibody (SinoBiological, 1:100) and rabbit Claudin 7 polyclonal antibody (ThermoFisher, 1:200) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The iPSCs were then cultured for 7 days in Neurobasal/DMEM-F12 medium (1:1 v/v) containing 2% B27 (Gibco, 17054–044), 1% N2 (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmids (1 μg of guide RNAs +/- 3 μg donor) were diluted in 1 ml OptiMem (Gibco) and 20 ul PEI (1 mg/ml) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Undigested and digested products were resolved in a 3% Metaphor 1:1 (lonza)/agarose gel (Invitrogen) gel ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Microbiology 2022Quote: ... 1/10 volume of 3 M sodium acetate and 1 μL glycogen 10 mg/mL (Thermofisher). Pellet obtained by centrifugation 15000 x g ...
-
bioRxiv - Biophysics 2021Quote: ... 1 µM of TO-PRO-3 iodide (Thermo Fisher, T3605) was added for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... embryos were incubated in ToPro-3 (1/1000, Molecular Probes) for 1h as previously described (Roussigné et al. ...
-
bioRxiv - Microbiology 2019Quote: ... or anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000; Ambion), or anti-p24 (1:1,000 ...