Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6 Hydroxy 1 iodonaphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were next treated with 1: 1000 dilution of primary antibody (6-His tag mouse anti-tag, Invitrogen) for 1 hr at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... coated 6-well plate with 1x mTeSRTM-1 medium and passaged with TrypLE Express (Gibco by Life Technologies) and plated in medium containing 3uM Rho-kinase inhibitor Y-27632 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were then washed 6× and 50 µl of 1-Step™ 3,3’,5,5’-tetramethylbenzidine (TMB; Thermo Fisher) substrate was added to each well and incubated for 3 min ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa SMC4-AID_WAPL-dTAG cells were supplemented with blasticidin S (6 µg mL-1, Thermo Fisher Scientific, A1113903) and hygromycin B (0.3 mg mL-1 ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Genomics 2023Quote: ... Cells were then co-transfected with the two plasmids at a molar ratio of 6:1 (2.5 μg of homology vector, ∼0.7 μg of sgRNA vector) using Lipofectamine2000 (ThermoFisher). The next day ...
-
bioRxiv - Neuroscience 2023Quote: ... coated 6-well plate with 1x mTeSRTM-1 medium and passaged with TrypLE Express (Gibco by Life Technologies) and plated in medium containing 3uM Rho-kinase inhibitor Y-27632 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear staining was performed using 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng ml−1; Molecular Probes). Sections were cover-slipped using ProLong Glass mounting agent (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were subcultured at a ratio of 1:10 every 5–6 days using 0.5 mM EDTA (Invitrogen) to detach clumped cells.
-
bioRxiv - Microbiology 2024Quote: ... Beads were washed 6 times with 1 mL each of ChIP buffer on a magnetic tube rack (Invitrogen). After removing the final wash ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with Alexa-Flour-488 or 555 secondary antibodies (1:1000) along with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Camarillo, CA, 1:1000) for 1 hr at room temperature (RT) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Genomics 2020Quote: ... on the QuantStudio 6 Flex (Life Technologies). Next ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). Samples were analyzed using a two-step amplification and melt curves were obtained after 40 cycles ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). The Ct values were analyzed by the enrichment compared to input method.
-
bioRxiv - Bioengineering 2019Quote: ... Novex TBE - DNA retardation gels (6%) – (ThermoFisher) were used for the electrophoresis.
-
bioRxiv - Neuroscience 2019Quote: ... in 6-well culture plates (ThermoFisher Scientific) with 800 µL of sterile medium added below the insert (Stoppini et al. ...
-
bioRxiv - Microbiology 2019Quote: ... 6’-diamidino-2 phenylindole (DAPI) (Life Technologies), and visualized on a Nikon TiE fluorescent microscope using 60X oil immersion objective ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Neuroscience 2020Quote: ... with 6 μl of RNaseout (Life Technologies). The lysates were sequentially treated with 12.6 μl of RNase-free DNase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Neuroscience 2019Quote: ... on a QuantStudio 6 (ThermoFisher, Waltham, MA) real-time PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... in a QuantStudio 6 thermocycler (Applied Biosystems) or in a StepOne Plus thermocycler (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 6 ug/mL Puromycin (Gibco #A1113803).
-
bioRxiv - Microbiology 2019Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies) at 0.1 ng/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... 12 (Fisher Scientific DF2948-47-6; RRID:AB_2884995); Mouse mAb anti-Cdc42 (BD Biosciences 610928 ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 6% TBE gel (ThermoFisher Scientific, EC62655BOX), and imaged with 4200 TapeStation (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Neuroscience 2022Quote: ... Magnesium Chloride (Fisher Scientific- 7791-18-6); Di Sodium Hydrogen O-phosphate (Fisher Scientific- 7558-79-4) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6) mounted in ProLong Diamond (ThermoFisher) and cured for 24 hours at room temperature before imaging ...
-
bioRxiv - Cell Biology 2022Quote: ... or 6 μl turbofect (ThermoFisher Scientific, R0531), and was mixed and incubated for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... on 6-well NUNC™ plates (ThermoFisher) coated with Geltrex™ (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... using a Quantstudio 6 Flex (Applied Biosystems) system in accordance with MIQE guidelines (26) ...
-
bioRxiv - Neuroscience 2021Quote: ... in 6-well culture plates (ThermoFisher Scientific) with 800 μL of 37°C pre-heated sterile medium (MEM Eagle medium 78.8% (Gibco #11095) ...