Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6 Chloro 4 methylamino pyridine 3 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... succinimidyl ester (ThermoFisher Scientific, P36600), or the pH-insensitive dye ...
-
bioRxiv - Microbiology 2023Quote: ... succinimidyl ester (ThermoFisher, Waltham, MA) from a 1mg/150μL stock solution in DMSO (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... The carboxyl groups on the bead surfaces were functionalized with amine-reactive groups via N- ethyl-N’-(3-(dimethylamino)propyl)carbodiimide (EDC) and sulfo-N-hydroxysuccinimide (sulfo-NHS, Thermo Fisher) crosslinking for 20 minutes at 4°C ...
-
bioRxiv - Systems Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1× MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco) and 50 µM 2-Mercaptoethanol (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Biochemistry 2022Quote: ICabs A4 and B7 were labelled with NHS-Rhodamine (5/6-carboxy-tetramethyl-rhodamine succinimidyl ester, ThermoFisher Scientific (catalogue no. 46406)) as described by the manufacturer ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Biophysics 2022Quote: ... BODIPY FL NHS Ester (Succinimidyl Ester) (NHS-BODIPY; catalog number: D2184) were purchased from Invitrogen.
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) was applied to nuclei samples at a concentration of 0.1µg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher), rinsed with TBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Bioengineering 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, NucBlue Fixed, Life Technologies) for cell count and nuclear aspect ratio ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI;ThermoFisher) and mounted with Vectashield H1400 Hardset Mounting Medium (Vector Labs) ...
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4’,6-diamino-2-phenylindole, Life Technologies, Ref#D3571) and Calcein AM staining profiles and Calcein AM (Life Technologies ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen Cat. D1306), was added ...
-
bioRxiv - Microbiology 2023Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) and LACV antibody as described below ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Immunology 2020Quote: ... and ethyl ether were purchased from Fisher Scientific. Peptides were synthesized using automated Fmoc SPPS chemistry (Syro I) ...
-
bioRxiv - Microbiology 2023Quote: Ethyl acetate (EtOAc; J.T. Baker and Fisher Scientific) and Optima-grade methanol (MeOH ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Microbiology 2021Quote: ... lysates were spun at 10,000 x g for 10 minutes at 4 °C prior to reaction with 4- acetamido-4’-maleimidyl-stilbene-2,2’-disulfonic acid (AMS) (ThermoFisher Scientific). AMS alkylation was performed by vortexing the lysates in 15 mM AMS ...
-
bioRxiv - Biophysics 2021Quote: ... 20 μL of Alexa fluor 488 NHS ester (or succinimidyl ester) (ThermoFisher Scientific, product number-A20000) (5mg/ml ...