Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 4 Nitrophenyl beta D glucuronic acid sodium salt since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: Cells were grown in DMEM growth medium ([+] 4.5 g/L D-Glucose, [+] L-Glutamine, [+] 110 mg/L Sodium Pyruvate, Gibco, supplemented with 10 % FBS ...
-
bioRxiv - Biophysics 2020Quote: ... they were keep in DMEM growth medium ([+] 4.5 g/L D-Glucose, [+] L-Glutamine, [+] 110 mg/L Sodium Pyruvate, Gibco, supplemented with 10 % FBS ...
-
bioRxiv - Biophysics 2020Quote: MCF7-p95ErbB2 cells described previously1 were grown in DMEM growth medium ([+] 4.5 g/L D-Glucose, [+] L-Glutamine, [+] 110 mg/L Sodium Pyruvate, Gibco, supplemented with 10 % FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Fluo-5F pentapotassium salt and Alexa Fluor 594 hydrazide Na+ salt were purchased from Invitrogen. For in vitro pGlo and arrestin recruitment studies ...
-
bioRxiv - Neuroscience 2022Quote: ... c-organoids were washed in D-PBS before fixing in 4% PFA (ThermoFisher) for 15 minutes at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... and sodium bicarbonate (sodium bicarbonate 7.5% solution, Gibco). The cells were fixed with 3.7% paraformaldehyde (PFA)/PBS for 1h at RT ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium for HT-1197 and HT-1376 was supplemented with 1x non-essential amino acids and 1 mM sodium pyruvate (Gibco). All culture media were supplemented with 10% fetal bovine serum (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... media for Calu-3 and Caco-2 cells were supplemented with 1x non-essential amino acid solution (from 100x stock, PAA) and 1 mM sodium pyruvate (GIBCO). Cell lines were validated by STR-typing ...
-
bioRxiv - Immunology 2021Quote: ... splenic NK cells were isolated and suspended in NK cell medium (phenol-red free RPMI 1640 containing 10% FCS, non-essential amino acids, L glutamine and sodium pyruvate, all from Gibco). The indicated target cells were labelled with 15μM Calcein-AM (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE1 cells were cultered in advanced DMEM/F-12 + non-essential amino acids + 110mg/L Sodium Puruvate (Gibco, Lot#12634010) supplemented with 10% (vol/vol ...
-
bioRxiv - Immunology 2022Quote: ... were harvested bilaterally into cold complete RPMI media (cRPMI; 10% FBS [Gibco], 1% penicillin/streptomycin [Gibco], 1% sodium pyruvate [Gibco], 1% non-essential amino acids [Gibco] ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM sodium pyruvate solution and 1% MEM non-essential amino acids solution(100X) (Gibco by Life Technologies, NY, USA). Murine monoclonal IgG1 anti-human CD13 (Mab C ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM sodium pyruvate solution and 1% MEM non-essential amino acids solution(100X) (Gibco by Life Technologies, NY, USA). Murine monoclonal IgG1 anti-human CD13 (Mab C ...
-
bioRxiv - Bioengineering 2022Quote: ... resuspended in RPMI growth media (RPMI supplemented with 10% FBS, 1x non-essential amino acid solution [Gibco 11140050], 1 mM sodium pyruvate [Gibco 11360070] ...
-
bioRxiv - Immunology 2021Quote: ... in cRPMI (2% BSA FFA-free [Fisher BP9704100], 1mM of Sodium Pyruvate [Gibco, 11360-070], Glutamax 1x [Gibco, 35050-061], MEM non-essential amino acids [Gibco, 11140-050] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and suspended at a density of 50,000 cells/well in a non-TC-treated 24 well plate in 800uL of pre-mixed differentiation media (Glasgow’s Modified Eagle Medium [Gibco], 1x PenStrep [Gibco], 1x Modified Eagle Medium Non Essential Amino Acids [Gibco], 1x Sodium Pyruvate [Gibco] ...
-
bioRxiv - Biochemistry 2023Quote: ... cultured in Minimum Essential Medium (MEM) supplemented with 1 % sodium pyruvate and 1 % non-essential amino acids (Gibco, Invitrogen®). All media were supplemented with GlutaMAX® (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... resuspended in 700 μL complete RPMI media (cRPMI; 10% FBS [Gibco], 1% penicillin/streptomycin [Gibco], 1% sodium pyruvate [Gibco], 1% non-essential amino acids [Gibco] ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% Fetal Bovine Serum (EuroBio) and 1% Pen/Strep + 1% Sodium Pyruvate + 1% Non-Essential Amino Acids solution (Gibco) at 37°C in 5% CO2 humidified incubators ...
-
bioRxiv - Cell Biology 2023Quote: ... and HEK293T/17 cells (ATCC CRL-11268) were maintained in DMEM (L-glutamine, Sodium Pyruvate, Non-essential amino acids; Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... cultured in Minimum Essential Medium (MEM) supplemented with 1 % sodium pyruvate and 1 % non-essential amino acids (Gibco, Invitrogen®). All media were supplemented with GlutaMAX® (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... solutions prior to being placed in developer solution (2.5% sodium carbonate, 0.1% ammonium nitrate, 0.1% silver nitrate, 1% tungstosilicic acid, 0.7% formaldehyde (Thermo Fisher Scientific, MA, USA). Slides were treated with 0.5% acetic acid to stop the reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... from day 1-2 Sprague-Dawley rats and maintained in DMEM (L-glutamine, Sodium Pyruvate, Non-essential amino acids; Gibco) supplemented with 2% FBS (Gibco ...
-
bioRxiv - Immunology 2024Quote: Colitis caused by DSS was induced in C57BL/6 wild-type mice as in Gpbar1+/+ and Gpbar1-/- mice by administering 2% DSS (DSS: Dextran Sulfate, Sodium Salt of Affymetrix USA, molecular mass 40–50 kDa) in drinking water for 9 consecutive days ...
-
bioRxiv - Bioengineering 2021Quote: FBS free culture media with 15mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Gibco) in DMEM/F12 supplemented with 1% P/S was used for all experiments performed in the lung on a chip devices ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated in EBSS supplemented with the indicated amino acid (4 mM) (Fisher Scientific) for one hour prior to addition of 25 ug/ml cycloheximide to the medium.
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 1M (ThermoFisher, ref. 15630106) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... four-day retinoic acid treated EBs were fixed with 4% PFA (Thermo Scientific, #28906) for 30 min ...
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Microbiology 2024Quote: ... the resuspension solution also included 4% (w/v) casamino acids (Fisher Scientific cat. #BP1424). I diluted the resulting cell suspensions 1:40 into MOPS minimal medium without micronutrients containing 0.2% glucose ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Neuroscience 2021Quote: ... P0-2) animals were removed and placed in 4°C cooled Hank’s Buffered Salt Solution (HBSS; GIBCO Life Technologies, Germany). Hippocampi were carefully dissected out and placed in Neurobasal-A Medium supplemented with B27 ...
-
bioRxiv - Neuroscience 2021Quote: ... P0-2) animals were removed and placed in 4°C cooled Hank’s Buffered Salt Solution (HBSS; GIBCO Life Technologies, Germany). Hippocampi were carefully dissected out and placed in Neurobasal-A Medium supplemented with B27 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and the pellets were dissolved in 0.1% SDS/ 0.67 M Tris-HCl pH 8 +/- 15 mM 4-acetamido-4’-maleimidylstilbene-2,2’-disulfonic acid (Thermo Fisher Scientific, USA). The samples were incubated at 37 °C for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Click-iT reaction cocktail (100 Mm Tris-buffered saline, 4 mM CuSO4, 100 mM ascorbic acid and 4 µM Alexa FluorTM488 azide (Invitrogen #A10266) was used for detecting EU ...
-
bioRxiv - Genetics 2022Quote: ... Larval brains were fixed in 25 ml of acetic acid: 4% formaldehyde in PBS (45%:55%) for 4 min on a clean Superfrost plus slide (Fisher Scientific) and the sample was manually squashed via thumb/stamp over coverslip ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-Microglobulin-Mm00437762_m1 (Applied Biosystems, Waltham, MA). Gene expression levels were normalized to β-2-microglobulin ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 mM Beta-Mercaptoethanol (Gibco, Cat. No. 31350010), 1000 units/mL LIF (Millipore ...
-
bioRxiv - Genomics 2021Quote: ... 2 μl of beta-agarase (Thermo Fisher Scientific) were added for agarose digestion and the reaction was incubated at 43 °C for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2% n-Dodecyl-beta-Maltoside Detergent (Thermo Scientific). For lysis tests ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.055 mM beta-mercaptoethanol (Thermo Fisher Scientific), with fresh medium added weekly ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.1 mM Beta-mercaptoethanol (Fisher Scientific, #21985-023), Primocin (Fisher Scientific ...