Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... in Retinal Differentiation Media (DMEM/F12 nutrient mix (3:1 ratio, Gibco), 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... After 1–3 h incubation with Alexa Fluor-conjugated secondary antibodies (Invitrogen) followed by DAPI staining (0.1 μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... TO-PRO™-3 iodide (Thermo Fisher; #T3605; 1:1,000 in PTwH.) As secondary antibodies donkey anti-rabbit Alexa Fluor® 568 (Thermo Fisher ...
-
bioRxiv - Paleontology 2021Quote: ... and finally stained with 1 μM To-Pro-3(Invitrogen, CA, USA) for 30min ...
-
bioRxiv - Bioengineering 2022Quote: ... was diluted 1:250 in 3% BSA/0.1% tween-20 (Fisher Scientific) and incubated for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin Receptor β CT-3 mouse monoclonal antibody (1:1000, AHR0271, ThermoFisher), Perilipin-1/PLIN1 D1D8 rabbit monoclonal antibody (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... cells were passaged 1:15 every 3 days using trypsin (Gibco, 25300054) and centrifugations at 200 xg ...
-
bioRxiv - Cell Biology 2024Quote: ... and replaced with M2 containing 1 μM TO-PRO-3 iodide (ThermoFisher). A SpectraMax i3X multimode detection platform equipped with a MiniMax cytometer (Molecular Devices ...
-
bioRxiv - Plant Biology 2023Quote: ... and precipitated with 1/10 volume of 3 M Sodium Acetate (Invitrogen), 2 μL GlycoBlue (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... transfection reagent at a ratio of 1:3 DNA:Fugene in optiMEM (Gibco). SARS-2 PV were harvested at 48h post transfection and supernatant filtered through a 0.45 μm acetate cellulose filter (Starlab ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were counterstained with TO-PRO™-3 Iodide (Invitrogen, 1:2000). For immunofluorescence detection of DEK or PCNA cells were fixed with 4% PFA/PBS (20 min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... + hydrogen peroxidase 3% (1:100, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... and extracted total RNA using BCP (1-bromo-3-chloropropane; Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... mouse anti-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:50000, Thermo Fisher, AM4300), mouse anti-CASQ1 (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... following a 3-hours treatment with 100 ng ml−1 colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... samples were incubated with TO-PRO-3 Iodide (1:1000, Life Technologies) in 1x PBS for 20 minutes and then mounted with VectaShield mounting media (Vector Laboratories) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Synthesized cDNA was diluted 1:3 and QS5 or QS6 (Life Technologies) systems were used for performing RT-qPCR analyses ...
-
bioRxiv - Immunology 2024Quote: ... at a DNA mass ratio of 3:1 in Opti-MEM (ThermoFisher). After a 10 minute incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... TO-PRO-3 (1:3000; Thermo Fisher Scientific, cat. #T3605, Waltham, USA) or DAPI (1:2000 ...
-
bioRxiv - Biophysics 2024Quote: ... were cleaned and silanized with 1% 3-aminopropyl-trimethoxysilane solution (Acros Organics) for 10 min and then treated with 0.5% glutaraldehyde (Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The mounting slide (3’’ x 1’’ x 1mm, Fisher Scientific, Pittsburgh, PA) was placed on top of the cover slide to finish preparation ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Biochemistry 2023Quote: ... samples were blotted at 100% humidity for 3 s (13°C, 0 s drain time, blot force -3 to +2) with a Vitrobot Mark IV (Thermo Fisher Scientific) and plunged into liquid ethane ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 mM DTT, 50 mM HEPES, 3 mM MgCl2, 2 mM PMSF, 1 Pierce™ protease inhibitor mini tablet/2 L; Thermo Scientific). The lysate was sonicated then incubated with 500 units/1 L culture Benzonase Nuclease (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons are washed 2-3 times with Neurobasal-A medium (Gibco) prior to fixation.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...