Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 3 Bromo 4 8 dichloro 5 methoxyquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... sequence is 5’-GCCGACCAAUUCACGGCCG-3’ and siRNA directed against GNA11 (siGNA11) is 5’-AAAGGGUACUCGAUGAUGC-3’) using Lipofectamine™ RNAiMAX (13778150, Fisher Scientific) and harvested 48 h post-transfection.
-
bioRxiv - Genomics 2024Quote: ... liver and muscle tissues from a total of 72 fish (n = 8 salmonid species x 3 biological replicates x 3 tissues) using TRIzol (Invitrogen/Life Technologies) with glass mill beads (1mm ...
-
bioRxiv - Immunology 2020Quote: ... and 5 ng/ml IL-4 (Life Technologies), and evaluated on day 6 of culture ...
-
bioRxiv - Microbiology 2022Quote: ... 4 µL linear acrylamide (5 mg/mL, ThermoFisher), and 1 mL of ice-cold 96% ethanol followed by overnight incubation at −20°C.
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL 5× phusion HF buffer (Thermo Scientific), 4 μL 5 M Betaine (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-cleaved-caspase-4/5 (Invitrogen, # PA5-39873),anti-cleaved caspase-3 (CST ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 µM di-4-ANEPPDHQ (Invitrogen, #D36802) in DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Cell Biology 2024Quote: ... or luciferase siRNA (5’ CGUACGCGGAAUACUUCGA 3’, control) were transfected in above RPE1 cells using 4 µl of lipofectamine siRNAmax (Thermo Fisher Scientific, 13778075) and 10 µM of siRNA in 2 ml of cell culture media ...
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were seeded at 4 x 104 cells per well on 4-or 8-well chambered slides (ThermoFisher Scientific, 154534) one day prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Immunology 2022Quote: ... followed by incubation for 8 min using 5 μM CellTrace Violet dye (Invitrogen). Following fluorescent labeling ...
-
bioRxiv - Microbiology 2022Quote: Vero cells were cultured for 5−8 passages in DMEM medium (Gibco, USA) with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Genetics 2021Quote: ... SDS-Page separation was completed by running between 3 and 10μg of total protein on a NuPAGE 3%–8% Tris-acetate gel (Thermo Fisher Scientific Scientific). Next ...
-
bioRxiv - Genomics 2024Quote: ... liver and muscle tissues from a total of 72 fish (n = 8 salmonid species x 3 biological replicates x 3 tissues) using TRIzol (Invitrogen/Life Technologies) with glass mill beads (1mm ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl) containing N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM; Invitrogen) at a final concentration of 10 μM and incubated for 30 min in the dark on ice ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) 4 mL modified SP-4 containing 40 mg/mL penicillin (Fisher Scientific, Hampton NH). Tubes 1 and 3 were incubated at 30 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Western blots were performed with NuPAGE Novex 3– 8% Tris-Acetate Protein Gels (Life Technologies).
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were resolved by SDS-PAGE on NuPAGE 3-8% Tris-Acetate precast gels (Thermofisher) and protein transfer was achieved using the iBlot™ 2 Gel Horizontal Transfer Device (Thermofisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein lysates were loaded on NuPAGE Tris-acetate 3-8% precast gels (EA03752BOX, Life Technologies) and ran at 150V for 1.5h ...
-
bioRxiv - Cell Biology 2021Quote: ... were passaged biweekly and maintained in 3 mL of Essential 8 Medium (Thermo Fisher Scientific) supplemented with 1% penicillin–streptomycin in 6-well plates coated with truncated recombinant human vitronectin (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... the lysates were run onto NuPAGE®3–8% Tris-acetate gels (Novex Life Technologies), and anti-Nup205 (Catalog No ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated by electrophoresis through 3-8% gradient SDS polyacrylamide tris-acetate gels (ThermoFisher), and transferred to polyvinylidene fluoride membranes (Cytiva ...
-
bioRxiv - Cell Biology 2022Quote: ... Anti-RME-8 (also called DNAJC13) was purchased from Fisher Scientific (Cat #70-277-3). Anti-VPS35 was purchased from Novus Biologicals (Cat #NB100-1397).
-
bioRxiv - Neuroscience 2022Quote: The remaining sections were washed 3×10 minutes with 8% sodium dodecyl sulfate (Fisher Scientific) to further reduce tissue autofluorescence ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were run on Nupage™ 3-8% Tris-Acetate Protein Gels (Thermo Scientific, EA03755BOX), using NuPAGE® Tris- Acetate SDS Running Buffer (20X ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein lysates were loaded on NuPAGE Tris–acetate 3–8% precast gels (EA03752BOX, Life Technologies) and subject to electrophoresis at 150 V for 1.5 h ...
-
bioRxiv - Biochemistry 2023Quote: Native-PAGE was conducted as described previously using 3-8% acrylamide Tris-acetate gels (Invitrogen) (44) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The soluble fraction was separated using 3-8% Tris-acetate NuPage gel (Novex/Life Technologies) and the proteins were transferred onto a nitrocellulose membrane (Invitrogen IB23001) ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were resolved by SDS-PAGE on 3%–8% Tris-Acetate gels (Thermo Fisher Scientific) and transferred to polyvinylidene fluoride (PVDF ...
-
bioRxiv - Neuroscience 2024Quote: ... Denatured protein lysates were loaded into 3-8% Tris-Acetate mini gels (Thermo Fisher Scientific), separated electrophoretically ...