Labshake search
Citations for Thermo Fisher :
4401 - 4450 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The tissue was dissociated into cells in DMEM containing 5% FBS (Gibco, 1008214) and 1% Penicillin/Streptomycin (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Microbiology 2020Quote: ... and reactions performed on the QuantStudio 5 Real-Time PCR systems (Thermo Fisher). Host gene expression was determined using the 2-ΔΔCt method and normalised to GAPDH expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... OSI-027 (5 μM, 10 μM, 25 μM, and 100 μM) (Fisher Scientific), and Everolimus (2 nM ...
-
bioRxiv - Immunology 2021Quote: ... for 20 min or 5 µM MitoSOX™ Red mitochondrial superoxide indicator (Invitrogen) for 10 min at 37 °C according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... iMD3 cells were growth in 5%KSR medium (Alpha-MEM (12571-063, Gibco); 5% KSR (10828028 ...
-
bioRxiv - Molecular Biology 2020Quote: 5 × 15cm plates of HEK293 Flp-In T-REx cells (ThermoFisher Scientific, R78007) at 80% confluency were harvested in 15mL DMEM media by trypsinization ...
-
bioRxiv - Microbiology 2021Quote: ... in a humidified incubator supplemented with 5% CO2 at 37°C (Thermo Scientific). HepAD38 cells were cultured as previously described26 ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were stained with the DNA-binding dye Hoechst (5 μg/ml; Invitrogen), and coverslips were mounted in mounting medium (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: Claudin-5 (mouse, clone 4C3C2, ThermoFisher cat# 35-2500, 1:100), Iba1 (goat polyclonal ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by a short 5 min incubation in a DAPI solution (Molecular Probes). A 5 min incubation in 1% Sudan Black B prepared in 70% ethanol was applied to quench autofluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5% CO2 and passaged twice a week using Trypsin-EDTA (0.25%) (Life Technologies). Cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The precipitants were washed 5-times using DynaMag-2 (Thermo Fisher Scientific, 12321D) and subjected to reverse transcription for quantitative real time PCR to quantify relative levels of CSDE1-associated Gpr151 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were stained for DAPI (Thermo Fisher R37606, 5 min at room temperature) before mounting coverslips on slides in Fluoromount (Sigma F4680 ...
-
bioRxiv - Neuroscience 2021Quote: ... either filled with 5 µl of 10% Fluoro-Ruby (Invitrogen, Carlsbad, CA, USA) or 5 µl of 2% Fast-Blue (Polysciences ...
-
bioRxiv - Immunology 2020Quote: ... first with 2 mM disuccinimidyl glutarate (ThermoFisher Scientific, 20593, CAS: 79642-50-5) for 30 minutes at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated in medium containing 20 mM EdU (5-ethynyl-2-deoxyuridine, Life Technologies) for the final 30 min and then washed with PBS and fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Biochemistry 2020Quote: ... The flow cell was incubated with 5 μg/ml of Neutravidin (Molecular probes) in RB for 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... livers were mechanically disrupted in 5 mL DMEM medium (Thermo Fisher scientific, USA) containing liver dissociation enzymes ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were maintained at 37 °C in 5% CO2 in Neurobasal Medium (Gibco) supplemented with 1x B27 and 1x Glutamax ...
-
bioRxiv - Cancer Biology 2021Quote: ... The samples were resolved on a 5-15% Bis-Tris gel (Thermo Fisher) followed by blotting ...
-
bioRxiv - Microbiology 2021Quote: ... (5) washed extensively and incubated with highly cross-absorbed anti-rabbit Alexa568 (ThermoFisher), anti-chicken IgY FITC (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR was performed using Quantstudio 5 (Thermo Fisher Scientific, Berlin, Germany) and GoTag®qPCR Master Mix with SYBR green fluorescence (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: NK cells were treated with 5 μM CellTrace CFSE (Invitrogen, cat no. C34554A) in RMPI media+ 5% FBS for 5 minutes ...
-
Cardiac fibroblasts regulate cardiomyocyte hypertrophy through dynamic regulation of type I collagenbioRxiv - Cell Biology 2022Quote: ... Wheat germ agglutinin (488) was from ThermoFisher (W11261; 5 µg/ml for IF).
-
bioRxiv - Biochemistry 2022Quote: ... a 1 ml click reaction containing 5 μl 1 mM Azide-488 (Invitrogen), 100 μl 20 mg/ml sodium ascorbate ...
-
bioRxiv - Immunology 2019Quote: ... adherent cells were cultured at 37°C with 5% CO2 in DMEM (GIBCO) plus 10% heat-inactivated FCS with penicillin ...
-
bioRxiv - Plant Biology 2019Quote: ... truncatula roots were inoculated with 5 μ of FM4-64 (Invitrogen, Molecular Probes) diluted from 5 mM stock in water to stain the endocytic organelles ...
-
bioRxiv - Plant Biology 2019Quote: ... truncatula roots were inoculated with 5 μ of FM4-64 (Invitrogen, Molecular Probes) diluted from 5 mM stock in water to stain the endocytic organelles ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.125 IU/mL Insulin (Novo Nordisk) and 5 ng/mL mEGF (Life Technologies). The human mammary epithelial cell line PMC42 was a gift from Professor Leigh Ackland (Deakin University ...
-
bioRxiv - Immunology 2019Quote: ... mice were injected with 100µg 5-Ethynyl-2′-deoxyuridine (EdU) i.p (Invitrogen, USA) and euthanized 4 hours later ...
-
bioRxiv - Developmental Biology 2019Quote: ... Embryo sections 5 μm thick were cut (Microm HM 335E; Thermo Fisher Scientific) and placed on glass slides (Matsunami Glass Ind. ...
-
bioRxiv - Immunology 2020Quote: ... 5×105 of human or mouse blood cells were incubated in αMEM (Gibco) including 10% (v/v ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were treated with 5 mg/ml FITC dextran (MW 40,000, ThermoFisher) for 30 min at 37 °C to target macropinosomes ...
-
bioRxiv - Cell Biology 2019Quote: ... then blocked and permeablized with 0.3% Triton X-100 + 5% Goat Serum (Gibco) in PBS for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were dislodged with PBS containing 5 mM ethylenediaminetetraacetic acid (EDTA; Life Technologies) (PBS-EDTA ...
-
bioRxiv - Cell Biology 2019Quote: ... Adherent cells were harvested after 5 min incubation in trypsin 0.05% EDTA (Gibco) and washes with PBS (Gibco) ...
-
bioRxiv - Molecular Biology 2019Quote: HeLa cells were cultured at 37°C and 5% CO2 in DMEM (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2019Quote: ... reduced with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP-HCl, Thermofisher Scientific) and then digested with 100 μg of Lys-C (Wako ...
-
bioRxiv - Systems Biology 2019Quote: ... 1: 5 000 000 ERCC RNA Spike-In Mix I (Thermo Fisher Scientific) in RNase-free water ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 ml round-bottom flask (PYREX) was rinsed with 100 % chloroform (Acros Organics) twice ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 μg/ml of Alexa546 or 647-conjugated fibrinogen (Thermo Fisher Scientific) in 100 mM NaHCO3 at pH 8.6 ...
-
bioRxiv - Systems Biology 2019Quote: ... 5 µL Lipofectamine LTX along with 2.5 µg PLUS Reagent (Thermo Fisher Scientific), and 20 nM final concentration HaloTag® TMRDirect™ Ligand ...
-
bioRxiv - Immunology 2019Quote: ... and the strainer rinsed with 5 mL of IMDM media (Invitrogen, Carlsbad, CA) containing 200 mM EDTA ...
-
bioRxiv - Developmental Biology 2020Quote: ... QuantStudio 5 or QuantStudio 12K Flex Real-Time PCR Systems (Thermo Fisher Scientific). qPCR primers were designed using NCBI tool Primer BLAST and are listed in Table S4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 5 μL of 2x Power SYBR Green PCR Master Mix (Thermo Fisher), and the reaction run for 30 cycles in a CFX Connect™ Real-Time PCR Detection System (Bio-Rad) ...