Labshake search
Citations for Thermo Fisher :
4251 - 4300 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... RT-PCR was performed on a StepOnePlus RT-PCR system (Invitrogen) with fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Real-time PCR of miR expression was carried out in a final volume of 10 µl using TaqMan MicroRNA Assays (Applied Biosystems) and normalized on RNU48 and RNU49 as endogenous controls ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized using a PrimeScript RT reagent kit followed by qRT-PCR using SYBR Green qPCR Master Mix on a StepOnePlus Real-Time PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturers’ protocols ...
-
bioRxiv - Systems Biology 2023Quote: ... We performed quantitative reverse transcription PCR (qRT-PCR) on the Bio-Rad CFX connect Real-Time PCR instrument with SYBR™ Green PCR Master Mix (Thermo Fisher Scientific) using primers qPCR_arc_fwd and qPCR_arc_rev for arc expression measurement ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR (qPCR) was performed using Power SybrGreen PCR master mix on a ViiA 7 real-time PCR system (Applied Biosystems). Expression of genes was normalised to three housekeeping genes (Gapdh ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 20-fold in PCR-grade water and subjected to real-time quantitative PCR (qPCR) using SYBR Green PCR Master Mix (ThermoFisher 4309155) with gene specific ...
-
bioRxiv - Genomics 2019Quote: We diluted mouse genomic DNA to 5 ng/ul and performed quantitative PCR using an Applied Biosystems 7500 Fast Real-Time PCR instrument and Power SYBR Green PCR Master Mix (Applied Biosystems) with the following cycling conditions ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative RT-PCR was carried out with either TaqMan™ Universal PCR Master Mix or SYBR Green PCR master mix on the QuantStudio 7 Flex Real time PCR system (Applied Biosystems). All reactions were carried out in either duplicate or triplicate and Ct values were obtained ...
-
bioRxiv - Plant Biology 2020Quote: We performed the quantitative reverse transcription-PCR (qRT-PCR) assays using SybrGreen Takara Master Mix in a 7500 Fast Real-Time PCR system (Applied Biosystems). For PCR ...
-
bioRxiv - Neuroscience 2021Quote: Real-time PCR was performed using the Applied Biosystems 7900HT Fast Real-Time PCR System with SYBR green PCR Master Mix (Applied Biosystems) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR was performed with QuantaFast SYBR Green PCR mix (Qiaqen) on a 7500 Fast Real-Time PCR system (Applied Biosystems). The following primers were used: mGAPDH F ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR was performed on the QuantStudio 7 Flex Real-Time PCR System using Power SYBR Green PCR Master Mix (Applied Biosystems). The PCR conditions were 950C for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription–quantitative PCRs were performed and analyzed using SYBR green PCR Master Mix and a StepOnePlus Real-Time PCR system (Applied Biosystems). Primer sequences are ACTB (endogenous control ...
-
bioRxiv - Cell Biology 2021Quote: ... we performed quantitative Real-time PCR (qRT-PCR) assays by using SYBR™ Green PCR Master Mix (Applied Biosystems, Waltham, MA). These experiments were carried out with the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... Real-time quantitative PCR was performed using the ViiATM 7 Real-Time PCR System and Power SYBRTM Green PCR Master Mix (4368708, ThermoFisher Scientific). Primers for HA (5’- AAACTCTTCGCGGTCTTTCCA-3’ sense sequence and 5’-GATAAGGTAGCTTGGGCTGC-3’ antisense sequence) ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... The quantitative Reverse Transcriptase-PCR (qRT-PCR) was performed on the QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems) with PowerUp™ SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was performed using the TaqMan Universal PCR Master Mix (Applied Biosytems) and a 7500 Real-Time PCR System (Applied Biosystems). Each condition was performed in duplicate ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed using SYBR Green PCR with the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA). The following primer sets were used ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative reverse-transcription-PCR (qRT-PCR) was performed on a QuantStudio™ 6 Pro Real-Time PCR System (Applied Biosystems A43182) in 384-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 30 ng of cDNA was used to perform the qRT-PCR reaction using SYBR green PCR master mix on an ABI Quant Studio 6 Flex Real-Time PCR System (Applied Biosystems). The housekeeping genes GAPDH ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA was amplified for real-time detection with TaqMan™ Gene Expression Master Mix (Thermo Fisher Scientific; #4369016) plus individual primers for IL-1β ...
-
bioRxiv - Immunology 2023Quote: ... SYBR Green-based real-time qPCR was performed using the ABI PRISM 7300 sequence detection system (Applied Biosystems). Gene expression was normalized to Hprt expression and assessed using Δ(ΔCt) ...
-
bioRxiv - Microbiology 2022Quote: ... This DNA-free RNA was then subjected to RT-PCR using the SuperScript III One-Step RT-PCR system with Platinum Taq DNA Polymerase kit (Invitrogen) with primers specific to the gene of interest (Supplementary Table 2).
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR was conducted using the Verso 1-Step RT-PCR Hot-Start kit (Thermo Fisher Scientific, Waltham, MA, USA). The primers used for RT-PCR were RGCP-NdeI-F (5’ ATGGCAAGGAAGAAGGGCAAATCGGCCA 3’ ...
-
bioRxiv - Genomics 2022Quote: ... Quantitative real-time polymerase chain reaction (RT-qPCR) was performed using Fast SYBR Green Master Mix (Applied Biosystems) and custom intron-spanning primers (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2024Quote: ... Real time quantitative polymerase chain reaction (RT-qPCR) was performed using SYBR Green (Applied Biosystems, San Francisco, CA) were used to assess TNF expression with the following forward and reverse primers (forward ...
-
bioRxiv - Cell Biology 2024Quote: ... A real-time search-synchronous precursor selection-MS3 (RTS-SPS-MS3) method7 was constructed in XCalibur (ThermoFisher Scientific) with the following parameters and then used ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized by using RT-PCR kit (Life Technologies). The real time PCR was performed by using SYBR green super mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... The AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems) was used for the amplification of the VP1 protein in segment B ...
-
bioRxiv - Genomics 2020Quote: We used a One-Step RT-PCR kit (Thermofisher 12595025) with custom primers to produce cDNA from the mRNA and subsequently ran 3 cycles of PCR which included a P5 adapter ...
-
bioRxiv - Bioengineering 2024Quote: RT-qPCR kit (CellsDirect One-Step qRT-PCR, Thermofisher, 11753100)
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared by RT PCR kit (Superscript III, Invitrogen), and BECN 1 (1st-445th amino acid ...
-
ALTERATIONS IN PEROXISOMAL-MITOCHONDRIAL INTERPLAY IN SKELETAL MUSCLE ACCELERATES MUSCLE DYSFUNCTIONbioRxiv - Cell Biology 2024Quote: ... using the Power SYBR Green RT-PCR kit (Applied Biosystems). The relative expression ratio of target gene was calculated based on PCR efficiency and quantification cycle deviation (ΔCq ...
-
bioRxiv - Microbiology 2020Quote: Quantitative Taqman real-time PCR (qPCR) was performed in duplicate on RT- and RT+ cDNA using 4x Taqman Fast Advanced Master mix (Applied Biosystems) on a 7500 Taqman PCR system ...
-
bioRxiv - Genetics 2020Quote: ... Real-time RT-PCR (RT-qPCR) characterization of Mlh3 splicing in mouse tissues was performed with TaqMan Gene Expression Assays (Applied Biosystems) following the manufacturer’s protocol on the CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
Splicing variation of BMP2K balances endocytosis, COPII trafficking and autophagy in erythroid cellsbioRxiv - Cell Biology 2020Quote: ... The qRT-PCR reaction was performed with the Kapa Sybr Fast ABI Prism qPCR Kit (KapaBiosystems) using a 7900HT Fast Real-Time PCR thermocycler (Applied Biosystems) with at least three technical repeats per experimental condition ...
-
bioRxiv - Cell Biology 2019Quote: ... Real time PCR was performed using Platinum SYBR green qPCR SuperMix-UDG kit with ROX reference dye (Thermo Fisher Scientific, 11733038) and a StepOne plus PCR system (Applied Biosystems) ...
-
Coloring inside the lines: genomic architecture and evolution of a widespread color pattern in frogsbioRxiv - Evolutionary Biology 2021Quote: ... The experiment was run using a StepOnePlus real-time PCR system and a Power SYBR Green RNA-to-CT 1-step kit (Applied Biosystems) on a volume of 20µl ...
-
bioRxiv - Genomics 2020Quote: ... qPCR was carried out using a BioRad CFX96 Real-Time PCR system using a SYBR Green qPCR kit (Thermo Fisher Scientific). The single copy Adh1 gene (Osterman and Dennis 1989 ...
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was conducted with the SensiMix SYBR® No-ROX Kit (Meridian Bioscience, Cincinnati USA) on an StepOne Plus Applied Biosystems Real-Time PCR instrument (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... To pool equimolarly the barcoded samples a quantification step by real time PCR using Ion Library TaqMan Quantitation Kit (ThermoFisher Scientific) was performed ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA sample amplification was performed with the KAPA SYBR FAST qPCR Kit (KapaBiosystems, KK4618) using the 7900HT Fast Real-Time PCR thermocycler (Applied Biosystems). Obtained data were normalized according to the expression level of the GAPDH (glyceraldehyde 3-phosphate dehydrogenase ...
-
bioRxiv - Cell Biology 2019Quote: ... The incubation and cycling conditions were set as described in the kit and the plates were analysed in a StepOnePlus Real-Time PCR System (Thermo Scientific).
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative PCR analysis was carried out using SYBR green (SensiFast SYBR No-ROX kit) on an Applied Biosystems 7500 Fast Real-Time PCR System (Fisher Scientific) in technical triplicates ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 µg of RNA using the qScript cDNA Synthesis Kit (Quanta Bioscience) and subjected to qPCR on a StepOnePlus Real-Time PCR System (Applied Biosystems) using SYBR green ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recovered DNA was subjected to quantitative real-time PCR using Platinum® SYBR® Green qPCR SuperMix-UDG Kit (Invitrogen) with specific primers for the targets of interest in 10µl reaction volume ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was quantified using real the Genesig® Real Time PCR Coronavirus COVID-19 (CE IVD) kit (Primer Design) using the manufacturer’s protocol and QuantStudio 5 Real-Time PCR System thermocycler (Thermo Fisher Scientific)
-
bioRxiv - Cancer Biology 2024Quote: ... analyses were then performed using SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology) on 7900HT Fast Real-Time PCR System (Applied Biosystems). Relative gene expression was calculated by 2^-ΔΔCt method normaized to the expression of ACTB ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA for real-time quantitative PCR (qPCR) was generated from total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time qPCR reactions were performed in triplicate as described (Risco et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR (qPCR) was performed using cDNA generated with the High Capacity cDNA Reverse Transcription kit (ThermoFisher Scientific, # 4368813) with SYBR Select Master Mix (Applied Biosystems ...