Labshake search
Citations for Thermo Fisher :
4251 - 4300 of 10000+ citations for Glutathione Reductase Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... we incubated the samples in blocking solution with fluorescent dye-conjugated secondary antibodies and the nuclear counterstain DAPI (ThermoFisher Scientific) at 4 °C overnight ...
-
Cortical cerebrovascular and metabolic perturbations in the 5xFAD mouse model of Alzheimer’s diseasebioRxiv - Neuroscience 2023Quote: The vessel painting technique is based on the ability of the fluorescent dye 1,1’-dioctadecyl-3,3,3’3’-tetramethylindocarbocyanine perchlorate (DiI, Life Technologies, Carlsbad, CA, USA) to bind to lipid membranes ...
-
bioRxiv - Physiology 2023Quote: ... Worms were then incubated overnight in the dark at room temperature with 33 µM SYTO 12 Green fluorescent nucleic acid stain (ThermoFisher) in NGM and a small amount of E ...
-
bioRxiv - Microbiology 2023Quote: ... Cryosectioned lung tissue sections (5 μm/section) from infected mice were stained using polyclonal anti-Ax rabbit sera and appropriate fluorescent conjugate secondary antibody (Invitrogen). Tight junctions were stained via a polyclonal goat antibody against ZO-1 and relevant secondary antibody (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: A Neuropixels probe phase 3A (imec, Belgium (Jun et al. 2017)) coated with a fluorescent dye (DiD, DiI or DIO, Thermofisher) was lowered slowly into the right SC and dPAG ...
-
bioRxiv - Biophysics 2023Quote: ... we extracted the Zernike weights characteristic of the microscope by acquiring multiple X-PSFs from fluorescent beads (FluoSpheres Tetraspeck beads from ThermoFisher) illuminated with 488 ...
-
bioRxiv - Bioengineering 2023Quote: The normal human fibroblast cell line IMR-90 (ATCC CCL-186) expressing the fluorescent protein GFP was cultured in Dulbecco’s Modified Eagle Medium (Gibco, USA) containing 4.5 g/L D-glucose ...
-
bioRxiv - Cancer Biology 2023Quote: ... The nuclear stain was visualized using a hemocytometer (INCYTO C-Chip; DHC-N01-5) through the Cy5 channel on an EVOS FL Auto Fluorescent microscope (ThermoFisher). Erythrocyte contamination was expressed as the percentage of “round donut-shaped DRAQ5 negative objects on bright-field” over the sum of “round donut-shaped DRAQ5 negative objects on bright-field” and “nuclear stained DRAQ5 positive cells”.
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 20 min at room temperature with 500 nM SYTO RNA Select green fluorescent dye in PBS (Invitrogen). Cells were washed three times with PBS and mounted with Prolong Gold Antifade mounting medium with DAPI (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... and deconvoluted with a point-spread-function inferred from TetraSpeck 100 nm fluorescent microspheres (Thermo Fisher Scientific T7279, Waltham MA) imaged with the same optical setup and processing ...
-
bioRxiv - Neuroscience 2023Quote: ... tRNAs were ligated to a Cy3-labelled fluorescent stem-loop RNA/DNA oligonucleotide and subjected to gel electrophoresis using a 10% TBE-UREA denaturing-polyacrylamide gel (Invitrogen). tRNA was visualized using a Licor Odyssey imaging system.
-
bioRxiv - Cancer Biology 2023Quote: Mitochondria content was analyzed using the mean fluorescent intensity of mitochondria structures stained with the Mitotracker green dye (Thermofisher scientific). Mean fluorescent intensity of each image was measured using ImageJ and normalized to the image area ...
-
bioRxiv - Cell Biology 2022Quote: Cellular glucose uptake was measured by culturing cells in glucose free DMEM for 2 hours before adding 100µM of the fluorescent glucose analogue 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; ThermoFisher, N13195). The analogue was incubated with MCF7s for 30 minutes and MSCs for 60 minutes at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... PANX1 and its mutants and PANX3 were transiently transfected into HEK293 cells with an enhanced green fluorescent protein (eGFP) using the transfection agent Lipofectamine 2000 (Invitrogen). The cells expressing GFP were selected for patch clamp electrophysiological recordings after 24-36 hours of transfection.
-
bioRxiv - Biophysics 2022Quote: EV concentration was normalized using a spiked-in external standard containing 200 nm orange (540/560) fluorescent beads (Invitrogen, F8809). The concentration of the beads was determined by Flow NanoAnalyzer N30 (NanoFCM ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µL of the complete medium were substituted with a suspension of fluorescent microparticles (Fluoromax, 0.2 μm, R200, Thermo Scientific) prior to addition of the remaining components ...
-
bioRxiv - Microbiology 2023Quote: ... and mCitrine fluorescent protein were amplified from plasmid pOXC101 (Pollak et al 2021) with the Phusion High-Fidelity PCR Master Mix (ThermoFisher) using primers JES003 (ATATCTCGAGGGCGCGCCTTGACAATTAATC ...
-
bioRxiv - Plant Biology 2023Quote: ... and RAF39 driven by the cauliflower mosaic virus (CaMV) 35S promoter and C-terminally tagged with green fluorescent protein (GFP) was achieved using Gateway LR Clonase II (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: α-IgLON5 AABs and pCtrl were conjugated with endosomal-pH sensitive red-fluorescent dye (pHrodoTM iFL Red STP ester, ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were stained with fluorescent vancomycin (VanFL, in which a BODIPY fluorophore is linked to a vancomycin molecule (Invitrogen)) and/or DAPI (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: ... This allowed for active stabilization of the system using the standard PSF of non-fluorescent 3 μm polystyrene beads (C37484, Invitrogen) in both lateral and axial dimensions using an open-source active stabilization ImageJ/Micromanager Plugin13 (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were transfected with a mitochondria-targeted fluorescent protein (PDH_GFP) or incubated for 15 min with 100 nM Mitotracker green (Molecular Probes) to stain the mitochondrial network ...
-
bioRxiv - Plant Biology 2023Quote: ... the entry vector was subsequently recombined into the Gateway-compatible plant binary vectors pGWB505(48) for C-terminal fusion with EGFP (Enhanced Green Fluorescent Protein) through Gateway LR reaction (Invitrogen). The 1053 bp native promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... the slides were sealed with an anti-fluorescent quenching solution (#P36961, ProLong™ Diamond Antifade Mountant, Invitrogen, Thermo Fisher, USA) for confocal microscopic observation (63× oil lens ...
-
bioRxiv - Molecular Biology 2023Quote: ... the slides were sealed with an anti-fluorescent quenching solution (#P36961, ProLong™ Diamond Antifade Mountant, Invitrogen, Thermo Fisher, USA) for confocal microscopic observation (63× oil lens ...
-
bioRxiv - Microbiology 2023Quote: ... pellets were resuspended in 200 µL DNA staining solution (0.9% NaCl in 0.1M HEPES, pH 7.2, 1.25 µM Invitrogen SYTO™ 60 Red Fluorescent Nucleic Acid Stain, Fisher Scientific, #10194852) followed by incubation for 20 min on ice ...
-
bioRxiv - Plant Biology 2024Quote: ... bound antibodies were detected using a goat anti-rabbit secondary antibody coupled to a fluorescent molecule (Alexa Fluor 680, Invitrogen) diluted 1:10,000 using the “Odyssey Infrared Imager” at 680 nm (Licor ...
-
bioRxiv - Molecular Biology 2023Quote: ... as already described [17] and reseeded onto 0.2 mm bone slices labelled with N-hydroxysuccinimide ester-activated rhodamine fluorescent dye (ThermoFisher Scientific), at a cell density of 1x105 cells/bone slice (Boneslices.com) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Intracellular NO production was assessed during reoxygenation by live-cell staining with the NO-sensitive fluorescent dye 4-Amino-5-Methylamino-2’,7’-Difluorofluorescein (DAF-FM) diacetate (Invitrogen). iPSC-ECs were stained with 1 μM DAF-FM diacetate for 10 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell suspensions were supplemented with LIVE/DEAD™ Fixable Dead Cell Stain Near-IR fluorescent reactive dye (Thermo Fisher, L34976), according to the manufacturer’s instructions (1 µl dye/1 ml PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell suspensions were supplemented with LIVE/DEAD™ Fixable Dead Cell Stain Near-IR fluorescent reactive dye (Thermo Fisher, L34976), according to the manufacturer’s instructions (1 µl dye/1 ml PBS for 1x106 cells ...
-
bioRxiv - Biophysics 2024Quote: ... replacing the caged dye in the HM with a small drop of 0.2-0.3 μl of a cytosolic fluorescent marker (3kD dextran conjugated to Alexa fluor 647 or Texas Red at concentrations of 3 mM; Invitrogen) that is applied from above just before electroporation to generate an inhomogeneous dye distribution around the animal during electroporation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Concentrations of miRNA mimic/inhibitor and transfection reagents were optimized using BLOCK-iTTM Alexa Fluor® Red Fluorescent Control (Ambion) as well as by mirVana™ miRNA mimic miR-1 positive control and mirVana™ miRNA Inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were then washed in PBS and incubated for 2h with appropriate secondary fluorescent antibodies Alexa Fluor 488/568 (all provided by Invitrogen): anti-rabbit (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... Remaining cells were washed with PBS and blocked with 10% rat serum and then incubated with following fluorescent monoclonal antibodies from Invitrogen: CD11b eFluor450 (Clone M1/70) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Following secondary fluorescent antibody incubation (Donkey anti-mouse conjugated Alexa Fluor 568, Donkey anti-Rabbit conjugated Alexa Fluor 488 or 647, Invitrogen), nuclei were stained with DAPI dye (1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... are thoroughly mixed and aliquoted column-wise according to the pattern of “Sample Plate 2” in a 96-well storage plate (AB0765, Thermo Fisher), using 100 µl of beads per well.
-
bioRxiv - Molecular Biology 2020Quote: ... Nunc 96-Well Polypropylene DeepWell Storage Plates (cat. 278743) and 96-well Nunc MicroWell 96-Well Optical-Bottom Plates (cat. 265301) were purchased from Thermo Scientific. Molecular weight cut off filters were purchased from Millipore-Sigma ...
-
bioRxiv - Developmental Biology 2019Quote: Cells were collected from either primed (E8 media on vitronectin-coated plates) or naïve (LIF-3i/MEF plates) conditions with Enzyme-Free Cell Dissociation Buffer (Gibco, 13151-014). Cells were washed in PBS and pelleted ...
-
bioRxiv - Microbiology 2021Quote: ... Single cells were sorted on a BD FACSAria II into 96-well PCR plates (MicroAmp Endura Optical 96-Well Clear Reaction Plates, Life technologies) into lysis buffer as described (49).
-
bioRxiv - Cancer Biology 2021Quote: ... 200nl of reconstituted siRNA from each well from the master plates was transferred to the same position of the corresponding black transparent bottom 384 well daughter plates (Thermo Fisher). Unused aliquoted plates were sealed with foil ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The plate was washed with PBS-T and the chemiluminescent signal was detected by a plate reader (Varioskan Flash, Thermo Scientific) after addition of ECL (1:1) ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out on 96-well plates (MicroAmp®Fast Optical 96-well Reaction plate, Applied Biosystems, Life Technologies) and 2 μl cDNA (10-20 ng diluted in nuclease-free water ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out on 96-well plates (MicroAmp®Fast Optical 96-well Reaction plate, Applied Biosystems, Life Technologies) and 2 μl cDNA (10-20 ng diluted in nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: ... The plate was washed with PBS-T and the chemiluminescent signal was detected by a plate reader (Varioskan Flash, Thermo Scientific) after the addition of ECL (1:1) ...
-
bioRxiv - Cell Biology 2022Quote: ... 250.000 HEK293T cells were seeded per p35 plate (pre-coated Corning BioCoat Poly-D-Lysine 35 mm #354467 or uncoated Nunclon multidish 6 well plates, Thermo Scientific #140685 coated with 50 µg/ml Poly-D-Lysine solution (Gibco A38904-01 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were mixed by inversion and 75µl of the suspension was dispensed to at least triplicate wells of 96-well blacked sided optical bottom plates culture plates (Thermo Scientific). At 40 hours post seeding ...
-
bioRxiv - Cell Biology 2021Quote: ... were manually excised using 21G needles/scalpel blades and grown in low-binding 96 well plates (96 well Nunc Sphera Round Bottom Plates, ThermoFisher Scientific) in Retinal Differentiation Media (DMEM/F12 nutrient mix (3:1 ratio ...
-
bioRxiv - Molecular Biology 2022Quote: ... 500ng circRNAs per well for 24-well plates (2 μg for 6-well plates) were transfected with lipofectamine MessengerMax (Invitrogen, LMRNA003) on the next day when the cell culture must have >90% viability and be 70% confluent ...
-
bioRxiv - Systems Biology 2022Quote: ... 1 µl out of 1.1 µl of sample was picked up out of a 384 well plate (Thermo AB1384) placed on an auto sampler height adjuster for PCR plates (ThermoFisher 6820.4089) and sealed by an aluminum foil cover (ThermoFisher AB0626) ...