Labshake search
Citations for Thermo Fisher :
4201 - 4250 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on an Applied Biosystems QuantStudio 3 Real-Time PCR System (Thermo Fisher, USA) using SYBR® Premix Ex TaqTM II (TaKaRa ...
-
bioRxiv - Developmental Biology 2024Quote: ... for quantitative reverse transcription PCR analysis on the StepOne/QuantStudio 6 Flex Real Time PCR Systems (Applied Biosystems). The housekeeping gene GAPDH was used as an endogenous control ...
-
bioRxiv - Neuroscience 2024Quote: ... qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using TaqMan gene expression assays (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... The samples were subjected to 45 PCR cycles in a thermocycler StepOnePlus Real-Time PCR System (Applied Biosystems). Abundance of satellite DNA from T ...
-
bioRxiv - Genomics 2024Quote: ... Transcript levels were quantified on a StepOnePlus Real-Time PCR system using the SYBR green PCR mix (ThermoFisher), and normalized to the total RNA concentrations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative Real-Time PCR (qRT-PCR) was performed using PowerUp SYBR Green Master Mix (A25778; Thermo Fisher Scientific) on an ABI StepOne Plus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The qRT-PCR was run on a StepOnePlus Real-time PCR system (Applied Biosystems, Foster City, CA, USA). Gene expression of individual mRNAs was normalized to HPRT using the ΔC(t ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCRs reactions were performed in technical duplicate using a StepOnePlus real-time PCR system (Thermo Fisher Scientific). Gene expression was calculated using ΔCT relative to the gyrA housekeeping gene and comparative ΔΔCT was determined by comparison of each time point to the ΔCT of the initial 2 h sample (∼0.05 OD600).
-
bioRxiv - Immunology 2023Quote: ... mRNA levels were evaluated in a two-step PCR reaction (StepOnePlus Real-Time PCR Cycler, Applied Biosystems, USA) with 60°C annealing/extension temperature for 40 cycles using the 2x qPCRBIO SyGreen Mix Hi-ROX (PCR Biosystems Ltd. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The qRT–PCR was performed using a QuantStudio™ 7 Flex Real-Time PCR System (Thermo Fisher Scientific). The sequences of primers and probes for Adar1 p150 and GAPDH have been previously reported (16) ...
-
bioRxiv - Immunology 2023Quote: ... mRNA levels were evaluated in a two-step PCR reaction (StepOnePlus Real-Time PCR Cycler, Applied Biosystems, USA) with 60°C annealing/extension temperature for 40 cycles using the 2x qPCRBIO SyGreen Mix Hi-ROX (PCR Biosystems Ltd. ...
-
bioRxiv - Neuroscience 2023Quote: ... and qRT-PCR was validated with the QuantStudio 1 Real Time PCR system (Applied Biosystems, Thermo Fisher Scientific). Expression level of target genes was calculated using the comparative method of relative quantification (2−ddCt ...
-
bioRxiv - Neuroscience 2023Quote: ... and qRT-PCR was validated with the QuantStudio 1 Real Time PCR system (Applied Biosystems, Thermo Fisher Scientific). Expression level of target genes was calculated using the comparative method of relative quantification (2−ddCt ...
-
bioRxiv - Immunology 2023Quote: ... The qRT-PCR experiment was done with an ABI 7500 Real Time PCR System (Applied Biosystems, Carlsbad, CA). Each cDNA sample of each target gene (TGF-β ...
-
bioRxiv - Bioengineering 2023Quote: ... quantitative real time PCR (qRT-PCR) was conducted using TaqMan™ Fast Advanced Master Mix (Thermo Fisher 444455) and analyzed on Quantstudio 7 Flex Real-Time PCR system (Thermo Fisher 4485701) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR progress was monitored by adding SYBR Green dye using StepOnePlus™ Real-Time PCR System (Applied Biosystems), and data were processed and quantified by StepOne™ Software (v2.0.2) ...
-
bioRxiv - Cancer Biology 2023Quote: ... real-time PCR (qPCR) was carried out in triplicates using Power SYBR Green PCR Master Mix (Applied Biosystems). Gene-specific ...
-
bioRxiv - Immunology 2023Quote: ... The mRNA levels were measured by quantitative PCR using a Step-One Real-Time PCR system (Applied Biosystems) with THUNDERBIRD probe qPCR Mix (TOYOBO ...
-
bioRxiv - Developmental Biology 2023Quote: Real-time PCR was performed using Applied Biosystems HT7900 with Power SYBR Green PCR Master Mix (Life Technologies) following standard protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The qRT-PCR assays were performed using the QuantStudio™ 5 Real-Time PCR System (ThermoFisher Scientific, USA) with the following cycling conditions for CHIKV ...
-
bioRxiv - Immunology 2023Quote: ... The samples were subjected to 45 PCR cycles in a thermocycler StepOnePlus Real-Time PCR System (Applied Biosystems). Abundance of satellite DNA from T ...
-
bioRxiv - Cancer Biology 2023Quote: ... Using qRT-PCR (QuantStudio 6, ThemoFisher Scientific) and the SYBR Green Real-time PCR master mix (Thermo Scientific), the expression levels of certain genes were determined.
-
bioRxiv - Genetics 2023Quote: ... Quantitative PCR was performed in triplicate on a QuantStudio 12K Flex Real-Time PCR System (Thermo Fisher Scientific) for five homozygous carriers of the NOA1 frameshift insertion and five matched controls ...
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with DyNAmo ColorFlash SYBR Green Master Mix (Thermo Fisher Scientific) on a CFX96™ Real Time PCR System (BioRad) ...
-
bioRxiv - Immunology 2024Quote: ... The qRT-PCR assays were performed in a QuantStudio 7™ Flex Real-Time PCR Systems (Applied Biosystems). Thermal cycling was performed at 25°C for 2 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR was performed through StepOne Plus RT-PCR (Applied Biosystems) using Power SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... RT-PCR was performed on a StepOnePlus RT-PCR system (Invitrogen) with fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Real-time PCR of miR expression was carried out in a final volume of 10 µl using TaqMan MicroRNA Assays (Applied Biosystems) and normalized on RNU48 and RNU49 as endogenous controls ...
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized using a PrimeScript RT reagent kit followed by qRT-PCR using SYBR Green qPCR Master Mix on a StepOnePlus Real-Time PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturers’ protocols ...
-
bioRxiv - Systems Biology 2023Quote: ... We performed quantitative reverse transcription PCR (qRT-PCR) on the Bio-Rad CFX connect Real-Time PCR instrument with SYBR™ Green PCR Master Mix (Thermo Fisher Scientific) using primers qPCR_arc_fwd and qPCR_arc_rev for arc expression measurement ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative PCR (qPCR) was performed using Power SybrGreen PCR master mix on a ViiA 7 real-time PCR system (Applied Biosystems). Expression of genes was normalised to three housekeeping genes (Gapdh ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 20-fold in PCR-grade water and subjected to real-time quantitative PCR (qPCR) using SYBR Green PCR Master Mix (ThermoFisher 4309155) with gene specific ...
-
bioRxiv - Genomics 2019Quote: We diluted mouse genomic DNA to 5 ng/ul and performed quantitative PCR using an Applied Biosystems 7500 Fast Real-Time PCR instrument and Power SYBR Green PCR Master Mix (Applied Biosystems) with the following cycling conditions ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative RT-PCR was carried out with either TaqMan™ Universal PCR Master Mix or SYBR Green PCR master mix on the QuantStudio 7 Flex Real time PCR system (Applied Biosystems). All reactions were carried out in either duplicate or triplicate and Ct values were obtained ...
-
bioRxiv - Plant Biology 2020Quote: We performed the quantitative reverse transcription-PCR (qRT-PCR) assays using SybrGreen Takara Master Mix in a 7500 Fast Real-Time PCR system (Applied Biosystems). For PCR ...
-
bioRxiv - Neuroscience 2021Quote: Real-time PCR was performed using the Applied Biosystems 7900HT Fast Real-Time PCR System with SYBR green PCR Master Mix (Applied Biosystems) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR was performed with QuantaFast SYBR Green PCR mix (Qiaqen) on a 7500 Fast Real-Time PCR system (Applied Biosystems). The following primers were used: mGAPDH F ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR was performed on the QuantStudio 7 Flex Real-Time PCR System using Power SYBR Green PCR Master Mix (Applied Biosystems). The PCR conditions were 950C for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription–quantitative PCRs were performed and analyzed using SYBR green PCR Master Mix and a StepOnePlus Real-Time PCR system (Applied Biosystems). Primer sequences are ACTB (endogenous control ...
-
bioRxiv - Cell Biology 2021Quote: ... we performed quantitative Real-time PCR (qRT-PCR) assays by using SYBR™ Green PCR Master Mix (Applied Biosystems, Waltham, MA). These experiments were carried out with the QuantStudio 6 and 7 Flex Real-Time PCR Systems (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: ... Real-time quantitative PCR was performed using the ViiATM 7 Real-Time PCR System and Power SYBRTM Green PCR Master Mix (4368708, ThermoFisher Scientific). Primers for HA (5’- AAACTCTTCGCGGTCTTTCCA-3’ sense sequence and 5’-GATAAGGTAGCTTGGGCTGC-3’ antisense sequence) ...
-
Loss of the mitochondrial citrate carrier, Slc25a1/CIC disrupts embryogenesis via 2-HydroxyglutaratebioRxiv - Developmental Biology 2024Quote: ... The quantitative Reverse Transcriptase-PCR (qRT-PCR) was performed on the QuantStudio™ 12K Flex Real-Time PCR System (Applied Biosystems) with PowerUp™ SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was performed using the TaqMan Universal PCR Master Mix (Applied Biosytems) and a 7500 Real-Time PCR System (Applied Biosystems). Each condition was performed in duplicate ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed using SYBR Green PCR with the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA). The following primer sets were used ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative reverse-transcription-PCR (qRT-PCR) was performed on a QuantStudio™ 6 Pro Real-Time PCR System (Applied Biosystems A43182) in 384-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 30 ng of cDNA was used to perform the qRT-PCR reaction using SYBR green PCR master mix on an ABI Quant Studio 6 Flex Real-Time PCR System (Applied Biosystems). The housekeeping genes GAPDH ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA was amplified for real-time detection with TaqMan™ Gene Expression Master Mix (Thermo Fisher Scientific; #4369016) plus individual primers for IL-1β ...
-
bioRxiv - Immunology 2023Quote: ... SYBR Green-based real-time qPCR was performed using the ABI PRISM 7300 sequence detection system (Applied Biosystems). Gene expression was normalized to Hprt expression and assessed using Δ(ΔCt) ...
-
bioRxiv - Microbiology 2022Quote: ... This DNA-free RNA was then subjected to RT-PCR using the SuperScript III One-Step RT-PCR system with Platinum Taq DNA Polymerase kit (Invitrogen) with primers specific to the gene of interest (Supplementary Table 2).
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR was conducted using the Verso 1-Step RT-PCR Hot-Start kit (Thermo Fisher Scientific, Waltham, MA, USA). The primers used for RT-PCR were RGCP-NdeI-F (5’ ATGGCAAGGAAGAAGGGCAAATCGGCCA 3’ ...