Labshake search
Citations for Thermo Fisher :
4201 - 4250 of 10000+ citations for Recombinant Human ITGAL & ITGB2 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: Qdot-labeled Cel7A was prepared by mixing 3 nM biotinylated Cel7A with 2 nM Qdot 655 (Thermo Scientific; catalog number: Q10123MP) in 50 mM sodium acetate ...
-
bioRxiv - Microbiology 2023Quote: ... double-biotinylated DNA fragments (215 bp) were obtained by PCR amplification of custom-synthesized DNA fragments (StringsTM DNA Fragments; Invitrogen, Germany) with biotinylated primers (Bio-icsB-for/Bio-icsB-rev) ...
-
bioRxiv - Immunology 2023Quote: 1-5 μg of total RNA from 2-3 MEF samples per group was used to prepare biotinylated RNA using the Ambion Illumina TotalPrep RNA Amplification Kit (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The protein concentration was determined and the antibodies biotinylated by incubating for 30 min at room temperature with EZ-Link NHS-PEG4-Biotinylation reagent (Thermo Scientific) at a 10:1 biotin-to-protein ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... and depleted the remaining biotinylated materials from the filtrate with 25 µL (slurry volume) of Pierce streptavidin magnetic beads (Thermo Scientific). Peptides in the supernatants were cleaned-up with C18 ZipTips (EMD Millipore ...
-
bioRxiv - Immunology 2023Quote: ... Phages presenting GSDMD-specific VHHs were enriched using chemically biotinylated GSDMD immobilized on Dynabeads™ MyOne™ Streptavidin T1 (Life Technologies). The retained phages were used to infect E ...
-
bioRxiv - Immunology 2023Quote: ... The nuclear extract was then spun at 21,000g for 5 minutes and the supernatant recovered and biotinylated using an EZ-Link Sulfo-NHS-LC-Biotin kit (Thermo Scientific). The solution was dialyzed using Slide-A-Lyzer® Dialysis Cassette G2 (cat# 87724 ...
-
bioRxiv - Neuroscience 2023Quote: ... injections into the spinal cord rostral to the lesion as a retrograde tracer or injections of biotinylated dextran amines (BDA, D1956; 10,000 kD, 10.0% w/v, ThermoFisher Scientific, Waltham, MA) into the motor cortex as an anterograde tracer to visualize the CST ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific, 5082385) for one hour at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... The biotinylated RNA was isolated by binding to 80 μl of a Dynabeads MyOne Streptavidin C1 bead suspension (Invitrogen Cat# 65001) by rotating the tube for 15 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Short fragments up to 1000 bp were produced via tagmentation and the biotinylated restriction junctions were then pulled down using MyOne C1 streptavidin beads (Life Technologies). PCR amplification (5 cycles ...
-
bioRxiv - Biophysics 2024Quote: ... MSP1E3D1 was expressed and purified as previously described (79) and biotinylated with EZ-Link NHS-polyethylene glycol 4 (PEG4)-Biotin (Thermo Fisher) per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The remaining portion of each sample was used in Streptavidin DynabeadTM-mediated pulldowns to isolate biotinylated RNA fragments following manufacturer protocol (ThermoFisher, 65001). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Retinal flat mounts were prepared and stained with biotinylated Isolectin GS-IB4 from Griffonia simplicifolia (0.2 mg/ml; Invitrogen, Carlsbad, CA) and Texas red-conjugated avidin D overnight at 4°C [29 ...
-
bioRxiv - Plant Biology 2019Quote: ... pEF1-MCS-3Myc [BamHI-NotI-3Myc-stop fragment was inserted between KpnI and XbaI sites of pEF1/myc-His B vector (Invitrogen)] was generated ...
-
bioRxiv - Microbiology 2020Quote: The parB genes were recombined into a Gateway-compatible destination vector pET-His-MBP-TEV-DEST 56 via an LR recombination reaction (ThermoFisher). For LR recombination reactions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was modified by replacement of the SV40 promoter by the Drosophila actin promoter from the pAct5.1/V5-His C vector (Thermo Scientific), and the firefly luciferase coding sequence by the Renilla luciferase (RLuc ...
-
bioRxiv - Neuroscience 2022Quote: Genes encoding the full-length sequences of Human PP2A A subunit and PP2A C subunit with N-terminal His tag and non-cleavable HA tag were sub-cloned into the pFastBac-Dual vector (Invitrogen). Sequences of PP2A A and C subunits are shown in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... The two pAcgp67-RBD (residues 333–530) plasmid with a C-terminal 8×His tag were transfected into Sf9 cells using Cellfectin II Reagent (Invitrogen) to produce the recombinant baculoviruses ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Biochemistry 2019Quote: ... the polynucleotides encoding GtACR1 mutants were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen) between EcoRI and NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... precipitate and soluble of was checked for the expression by SDS-PAGE and confirmed indirectly by Western blot with anti-his antibody (Invitrogen).
-
bioRxiv - Synthetic Biology 2019Quote: ... An anti-6His antibody (6x-His Tag Polyclonal Antibody) and an anti-HA antibody (HA Tag Polyclonal Antibody) were purchased from Invitrogen. Western blot analysis was conducted as described previously 45.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The BglII and EcoRI restriction sites were used to insert the sequence into the pMT/BIP/V5-His plasmid (ThermoFisher). The production of recombinant IrSPI protein was performed by the Recombinant Proteins in Eukaryotic Cells Platform ...
-
bioRxiv - Molecular Biology 2019Quote: ... Emulsion PCR was performed using the Ion PGM Hi-Q View OT2 Kit and the Ion OneTouch 2 system (ThermoFisher). Template-positive ion sphere particles (ISPs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Enriched ISPs were loaded on a PGM 314R v2 chip and sequenced using the Ion PGM Hi-Q View Sequencing Reagents (ThermoFisher). Raw sequencing data were processed using the Torrent Suite software v5.0 (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... TaTLP2-B gene was re-amplified from the confirmed clone using the same primers and ligated into the pYES2.1/V5-His-Topo vector (Invitrogen, USA). The recombinant plasmid (pYES2.1-TaTLP2-B ...
-
bioRxiv - Immunology 2021Quote: ... each mouse Siglec gene containing 2-3 domains with pairs of forward and reverse primers (Table S5) were cloned into pcDNA5/FRT/V5-His-TOPO vector (Invitrogen), which contained a C-terminal hIgG1-Fc ...
-
bioRxiv - Microbiology 2021Quote: ... with a N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen). The recombinant baculoviruses were generated according to the manufacture’s instruction to infect Hi5 cells at a density of 2×106 cells/ml ...
-
bioRxiv - Biophysics 2021Quote: The bacteriophage T7 gp15 gene was inserted into the pRSET-B vector (ampr and 6x-His tag) from Invitrogen (USA), between the XhoI and EcoRI restriction sites ...
-
bioRxiv - Biochemistry 2020Quote: ... the opsin-encoding constructs were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen). Mutants were generated with Quikchange XL kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... with a N-terminal 8x His tag was expressed from the pSJ2 vector (84) in BL21 E.coli and purified by Ni-NTA resin (Thermo Fisher). Full-length human Src kinase (WT or K298M ...
-
bioRxiv - Neuroscience 2020Quote: ... for 48 h then transfected for 24 h with 1 ug His-G3BP1 3’UTR constructs using Lipofectamine LTX and Plus reagent (Invitrogen). To determine mRNA stability ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml of Dynal sheep-anti mouse IgG paramagnetic beads were non-covalently coupled with 60 µg of anti-His mAb (Invitrogen) in PBS plus 0.1% immunoglobulin-free BSA (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... M-OPG2 and S-OPG2 were generated by inserting the respective cDNAs in frame between NheI and AflII sites of a pcDNA5/FRT/V5-His vector (Invitrogen) containing a C-terminal OPG2 tag (MNGTEGPNFYVPFSNKTG) ...
-
bioRxiv - Cell Biology 2021Quote: qPCR analysis was performed using the LabTaq Green Hi Rox (Labtech) following manufacturer’s instructions on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) and primers listed in Supplementary Table S4.
-
bioRxiv - Plant Biology 2021Quote: ... fused with a six-HIS tag at the C-terminus were expressed using the Bac-to-Bac baculovirus expression system (Invitrogen) in High Five cells at 22 °C as reported previously 23 ...
-
bioRxiv - Microbiology 2021Quote: ... Amplified fragments were digested with KpnI and XhoI and cloned into the pre-cut pcDNA4/myc-His A vector (Invitrogen) by using the DNA ligation Kit (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... with FLAG sequence flanking at 5’ end of the primer and cloned in Hind III and Xba I site of pCDNA3.1V5-His (Invitrogen, USA). Clones were sequenced with T7 and BGH primer using ABI BigDyeTerminator V3.1 cycle sequencing kit followed by automated sequencing in ABI 3130 Genetic Analyzer according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 2015) were produced from C6/36 cell line cultured in L-15 (HyClone) supplemented with 1.5% HI-FBS (ThermoFisher Scientific), 10% tryptose phosphate ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA coding for fibulin1C (Uniprot number P23142-4) with a C-terminal 6x His tag was custom-synthesized by Invitrogen and transiently transfected in HEK293 T cells using polyethylenimine in OPTIMEM (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lines were maintained in Ham’s F12 media (Hi Media, India) supplemented with (10%) fetal bovine serum (FBS, Gibco, USA). Plasmids were either expressed stably (FR-GPI ...
-
bioRxiv - Microbiology 2020Quote: ... using the primers in Table II and after digestion with BamHI and XhoI was cloned into pCDNA™3.1/myc-His A (Invitrogen). CHIKV structural genes were initially PCR amplified from pDONR21-CHKVstr (60 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Drosha cDNA with a Flag-tag at the amino-terminus and a 6 x his tag at the carboxyl-terminus was cloned into pcDNA4/TO (Invitrogen) to construct the inducible WT Drosha expressing plasmid for immunoprecipitation assay and ubiquitination assay ...
-
bioRxiv - Genomics 2020Quote: ... We then amplified the library using Hi-fidelity KAPA PCR kit (KAPA) for 6 cycles and quantified the library using Qubit high sensitivity DNA assay (Thermofisher). We performed QC using bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... We then amplified the library using Hi-fidelity KAPA PCR kit (KAPA) for 6 cycles and quantified the library using Qubit high sensitivity DNA assay (Thermofisher). We performed QC using bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2021Quote: The SARS-CoV-2 NTD (residues 13-303) or RBD (residues 319-541) with a C-terminal His tag was cloned into a modified pFastBac vector (Invitrogen) that encodes a melittin signal peptide before the NTD or RBD ...