Labshake search
Citations for Thermo Fisher :
4201 - 4250 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... high glucose (Life Technologies) at 37°C and 5% CO2 ...
-
bioRxiv - Plant Biology 2022Quote: ... high ROX (Thermo Scientific) on 2.5 μL of cDNA (diluted 1:20 ...
-
bioRxiv - Cell Biology 2022Quote: ... high-BSA DMEM (Gibco) containing 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... high glucose (DMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Genetics 2022Quote: ... high-glucose (Gibco 61965059), supplemented with 2% HI-FBS and 1% penicillin-streptomycin (Gibco 15140-122) ...
-
bioRxiv - Neuroscience 2024Quote: ... DMEM/high glucose (Gibco) with FBS (10%)(Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... high glucose (Gibco, 11965092), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... and high glucose (Gibco). WSN pcDNA3-based protein expression plasmids and pPol-based viral template RNA expression plasmids were described previously [61–63] ...
-
bioRxiv - Biophysics 2024Quote: ... (High Five, Thermo Fisher) cells were gown in ESF medium at 27°C and 120 rpm ...
-
bioRxiv - Bioengineering 2024Quote: ... high glucose (Gibco, 11965092) supplemented with 5% fetal bovine serum (Gibco ...
-
bioRxiv - Bioengineering 2024Quote: ... high glucose (Gibco, 11965092). Medium was supplemented with 10% Fetal Bovine Serum (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... high glucose (Thermofisher #11965092), 15% Fetal Bovine Serum ...
-
bioRxiv - Immunology 2024Quote: ... high-glucose DMEM (Invitrogen) (modified from Remsik et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were cleaned up and normalized with the SequalPrep Normalization Plate Kit (ThermoFisher Scientific) and pooled amplicons were quantified with the KAPA library quantification kit (KAPA Biosystems).
-
bioRxiv - Physiology 2019Quote: ... Normalization was performed using a SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, Darmstadt, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed and the substrate solution (TMB substrate Kit, Thermo Fisher Scientific # 34021) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were isolated from strain plates using a NEPER nuclear isolation kit (Thermo Scientific) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2020Quote: ... purified and normalized using a SequalPrep Normalization Plate (96) Kit (ThermoFisher Scientific, Waltham, MA). Samples ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... plates were scraped into PBS and plasmid isolated (GeneJET Plasmid Miniprep Kit, Thermo Scientific). Primers encoding 8-bp 5’ and 3’ barcodes were used to amplify samples from each condition.
-
bioRxiv - Microbiology 2019Quote: ... purified and normalized using a SequalPrep Normalization Plate (96) Kit (ThermoFisher Scientific, Waltham, MA). Samples ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted in 96-well plates using the PureLink DNA Extraction Kit (Invitrogen), using instructions for gram-positive bacteria ...
-
bioRxiv - Genetics 2022Quote: ... SequalPrep™ Normalization Plate Kit was used to normalize the amplicon concentration (Thermofisher Scientific). Sequencing was done using the Illumina MiSeq Reagent Kit V2 with V4 sequencing primers as described by Caporaso et al (2012 ...
-
bioRxiv - Microbiology 2022Quote: ... Purification and normalization of amplicons were performed using a SequalPrep plate kit (Invitrogen, USA), and the DNA concentration was measured with a Qubit® Fluorometer ...
-
bioRxiv - Microbiology 2024Quote: ... and mock community were normalized using SequalPrep Normalization Plate Kit (Invitrogen, Carlsbad, CA, USA) and pooled into equal volumes ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned and normalized using SequalPrep Normalization Plate Kit (Thermo Fisher Scientific), then quantified and pooled equimolarly according to Kapa Biosystems Library qPCR MasterMix (ROX Low ...
-
bioRxiv - Microbiology 2023Quote: ... Barcoded amplicons were again purified and normalized with the SequalPrep Normalization Plate Kit (Invitrogen), pooled ...
-
bioRxiv - Microbiology 2023Quote: ... Normalization was performed using the SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, Darmstadt, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were normalized using a SequalPrep Normalization Plate (96) Kit (A1051001; Invitrogen, Frederick, MD). Paired-end sequencing was performed on an Illumina MiSeq26 at the Nebraska Food for Health Center ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified PCR products were normalized using the SequalPrepTM normalization plate kit (ThermoFisher Scientific) and then pooled ...
-
bioRxiv - Microbiology 2024Quote: ... purified and normalized using a SequalPrep Normalization Plate (96) Kit (ThermoFisher Scientific, Waltham, MA). Samples ...
-
bioRxiv - Cell Biology 2024Quote: ... total RNA was first reverse transcribed using the High-Capacity cDNA Reverse Transcription kit as recommended by the manufacturer (Applied Biosystems, 25°C 10 min, 37°C 2 h, 85°C 5 min). The resulting cDNA was diluted 1:20 in RNase-free H2O and 3 µl dilution were used for RT-qPCR analysis using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was reversed transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kit (Fisher Scientific, #4374966). Real-time PCR was performed using iTaq™ Universal SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... reverse transcription into cDNA was conducted using the High-Capacity cDNA Reverse Transcription Kit (4368814, Life Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Complementary DNA (cDNA) was synthesized from total RNA using High-Capacity RNA-to-cDNA kit (Applied Biosystems). PCR was performed using StepOne Real-Time PCR System and Taqman Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg RNA samples were reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using the Power SYBR® Green PCR Master Mix and an ABI Prism 7300 Sequence Detection System instrument and software (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... and used for cDNA synthesis with the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, 4368814). In each 20 μl reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was prepared using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems™, Foster City, CA). PCR was performed with the 7500 Fast Real-Time PCR system (Applied Biosystems™ ...
-
bioRxiv - Genetics 2021Quote: ... 500 ng of RNA were reverse-transcribed using the High Capacity RNA-to-cDNA Kit (Applied Biosystems). Real-time quantitative PCR was then performed on resulting cDNAs in a Step-One Plus system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... Up to 1μg of RNA was reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). SYBR Green PCR Master Mix (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA was then converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was preformed using the Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) in a Thermo Hybaid PCR Express Thermal Cycler (Thermo Hybaid ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was made using the high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) using an equal amount of total RNA from each sample ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... cDNAs were synthesised from the purified RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Biological replications (n = 3-5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using a High-Capacity Reverse Transcription Kit (Applied Biosystems) and ultimately re-suspended in 200 µl of water ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cDNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, #4368814), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μg of RNA was then reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR was performed with 10ng of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... After reverse transcription into cDNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher, Waltham, MA, USA), the samples were randomized on RT-qPCR plates and analyzed for gene expression of Ace2 ...
-
bioRxiv - Immunology 2022Quote: ... and reverse transcribed to generate cDNA with High-Capacity RNA-to-cDNA™ Kit (Themo-Fisher Scientific) according to manufacturer’s directions ...
-
bioRxiv - Cell Biology 2022Quote: ... random primers and following the protocol of the high-capacity cDNA reverse-transcription kit (Thermo Fisher Scientific). mRNA expression levels of MIP1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse (Y2H term reverse: 5’ GGAGACTTGACCAAACCTCTGGCG) primers using Phusion High-Fidelity PCR Kit from Thermo Scientific, with a standard PCR program.