Labshake search
Citations for Thermo Fisher :
4151 - 4200 of 6212 citations for MORF4L2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... mouse embryonic fibroblasts (MEFs) in human embryonic stem cell (hES) media composed of Knock-out Dulbecco’s modified Eagle’s medium (DMEM) (Gibco), 10% knock-out-serum replacement (Gibco) ...
-
bioRxiv - Physiology 2020Quote: Human Embryonic Kidney 293 (HEK-293) cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, Thermo Fisher Scientific), supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2021Quote: ... the plates were incubated for 1 hr with horseradish peroxidase-(HRP) conjugated anti-human IgG1 (Thermo Scientific, A10648). Detection was performed using a two-component peroxidase substrate kit (BD biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Bound antibodies were detected by addition of horseradish peroxidase-labeled goat-anti-human IgG (Invitrogen, Carlsbad, CA, USA) followed by 1-Step Ultra TMB (ThermoFisher ...
-
bioRxiv - Pathology 2021Quote: ... followed by two TBT washes and incubation using a pTau AT8 mouse anti-human primary antibody (Thermofisher MN1020) at a dilution of 1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended in 250 μl PBS-B containing anti-human AlexaFlour-488-conjugated antibody (1:200; Thermo Fisher Scientific) and incubated again for 60 min at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and human RNase P (RP assay) together with TaqPath™ 1-Step RT-qPCR Master Mix CG (ThermoFisher). A plasmid containing the complete nucleocapsid gene from 2019-nCoV (IDT ...
-
bioRxiv - Bioengineering 2021Quote: Primary human T cells were thawed at Day 0 and activated with anti-CD3/CD28 Dynabeads (Thermo Fisher) at a 3:1 bead to T cell ratio and cultured in AIM V + 5 % heat-inactivated FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... MCF10A human mammary epithelial cells (ATCC) were cultured in 1:1 DMEM/F-12 (Thermo Fisher Scientific, USA) media which consists of 2.50 mM L-Glutamine and 15 mM HEPES buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 57 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Microbiology 2019Quote: Human HaCaT epithelial keratinocytes and Vero cells were propagated in Dulbecco’s modified Eagle’s medium (DMEM; Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: The siRNA duplex (21 nucleotides) against human cath-D siRNA (ID 4180) was purchased from Ambion (Austin, TX), and the firefly luciferase (Luc ...
-
bioRxiv - Cell Biology 2021Quote: Human epithelial colon adenocarcinoma, Caco2, cells (ACC 169, DSMZ, Leipzig, Germany) were grown in DMEM/F-12 (Gibco, Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA interference was performed using 10 pmol of duplexes targeting human MLKL (GCAACGCAUGCCUGUUUCACCCAUA, Stealth siRNA from Life Technologies) or non-silencing control duplexes (low-GC 12935111 ...
-
bioRxiv - Biophysics 2021Quote: The pTWIN1 vector containing human Httex1 fused to His6-SUMO was ordered from GeneArt Gene Synthesis (Life Technologies); E ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were then stained with 5 µL FITC anti-human DR4 (Thermo Fisher Scientific, Clone DR-4-02) for 30 min at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The control human IgG antibody for in vitro and in vivo studies was from Invitrogen (Carlsbad, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... 2011) were grown in human foreskin fibroblasts (HFF) monolayers in Dulbecco’s modified Eagle’s medium (DMEM) with GlutaMAX (Gibco) supplemented with 10% Nu-Serum (Gibco) ...
-
bioRxiv - Neuroscience 2022Quote: ... The human NPCs sourced from Polymenidou group (UZH) were plated in media supplemented with DMEM/F12 (Thermo Fisher), 0.5X B27-supplement (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: The human colon adenocarcinoma cell lines LS174T (derived from Caucasian colon adenocarcinoma) maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS (BI ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 48 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Bioengineering 2022Quote: ... the cells were incubated with primary antibodies such as rabbit anti-human ZO-1 IgG (Thermo Fisher Scientific) and mouse anti-human albumin IgG (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: ... was premised on a commercial human RNaseP primer/probe set (443328, Applied Biosystems, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Microbiology 2022Quote: THP-1 cells (1.0 × 106) were transfected with human siRNA (10 nM) using Lipofectamine 3000 (Invitrogen, Waltham, MA). All siRNAs were ON-TARGETplus SMARTpool (Dharmacon ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with human recombinant epidermal growth factor (rEGF) and bovine pituitary extract (BPE) plus 2% penicillin-streptomycin (Gibco) at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: Human embryonic kidney cells (293T; ATCC; ATCC CRL-11268) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco), 10% fetal calf serum (FCS) ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... and 1 μg/ml Recombinant Human Fibroblast growth Factor-basic (FGFb) (Catalog # 13256-029 Gibco, Thermo Fisher Scientific) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human CD8+ T cells were negatively isolated from PBMC and labeled with 5μM of Cell Trace Violet (Invitrogen) according to manufacturer’s specifications ...
-
bioRxiv - Microbiology 2022Quote: Human A549 cells (ATCC CCL-185) and its derivatives were cultured in RPMI 1640 (Gibco catalog no. 11875) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD8 and CD4 T cells were activated and expanded with Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher) per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... EGF-Cy3B was generated using NHS-Cy3B (Cytiva, Marlborough, MA) conjugated to recombinant human EGF (Gibco, ThermoFisher Scientific), using 1:1 labeling stoichiometry as described previously 60 ...
-
bioRxiv - Cell Biology 2022Quote: ... EGF-Cy3B was generated using NHS-Cy3B (Cytiva, Marlborough, MA) conjugated to recombinant human EGF (Gibco, ThermoFisher Scientific), using 1:1 labeling stoichiometry as described previously 60 ...
-
bioRxiv - Cell Biology 2022Quote: ... RNaseH1 was PCR amplified using human RNase H1 cDNA in pENTR221 plasmid (Ultimate ORF clones, IOH4870, ThermoFisher Scientific) as a template ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37 °C and 5% CO2 in EMEM (ATCC) supplemented with 0.01 mg/mL human recombinant insulin (Gibco) and 10% (vol/vol ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary chondrocytes were isolated from the articular cartilage of human joints and expanded in DMEM (high glucose; Gibco) supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... A codon-optimized vector expressing human spatacsin was generated (Baseclear, Leiden, Netherlands) in a gateway compatible system (Thermofisher). The cDNA was transferred by LR clonase into the pDest-47 vector (Thermofisher) ...
-
bioRxiv - Biochemistry 2021Quote: ... labeled with 50 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher Scientific Invitrogen Catalog # 12-4998-82) diluted in 1.95 mL TBSF for 10 minutes covered on ice ...
-
bioRxiv - Microbiology 2020Quote: Cytokine levels in sinus wash were quantified using a Luminex 35-Plex Human Panel (Invitrogen, Frederick, MD, USA).
-
bioRxiv - Neuroscience 2021Quote: ... human DRGs immediately were cut into 1-2 mm pieces and stored in RNA-later (ThermoFisher, Cat# AM7021). For ISH ...
-
bioRxiv - Microbiology 2021Quote: Human A549 type II alveolar epithelial cells (ATCC CL-185) were grown in Minimum Essential Medium (MEM, Gibco) supplemented with 8% heat-inactivated newborn calf serum (HI-NBCS ...
-
bioRxiv - Neuroscience 2021Quote: ... The primary antibody was incubated overnight at 4°C [human Pax6 polyclonal antibody (1:100, Thermo Fisher Scientific)] ...
-
bioRxiv - Microbiology 2020Quote: ... 100 units/ml Penicillin and 100μg/ml Streptomycin) supplemented with 12.5uL/mL of dynabeads human T-activator CD3/CD28 (Invitrogen), 2μg/mL anti-human IL-12 (PeproTech) ...
-
bioRxiv - Immunology 2020Quote: Allogenic CD8+ T-cells were isolated by negative selection using Dynabeads Untouched Human CD8 T Cells Kit (Invitrogen), labeled with carboxyfluorescein succinimidyl ester (CFSE ...
-
bioRxiv - Microbiology 2021Quote: ... HEK-293T overexpressing the human ACE2 were kindly provided by Integral Molecular Company and maintained in DMEM (Invitrogen) with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2021Quote: ... Differentiation of H9 ES cells was induced by exchanging human ES cell growth medium with DMEM/F12 (Gibco) containing 2 mM L-glutamine ...
-
bioRxiv - Cell Biology 2022Quote: Human proteins (LIS1-SNAP, or motor domains) were expressed and purified from insect cells (ExpiSf9 cells; Life Technologies) as previously described with minor modifications3,7,20,69 ...
-
bioRxiv - Microbiology 2022Quote: Toxoplasma gondii tachyzoites were amplified in human foreskin fibroblasts (HFFs, ATCC) in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 5% of Fetal Bovine Serum (FCS ...
-
bioRxiv - Physiology 2022Quote: Total RNA from human liver biopsies (10-20 mg) was extracted using Trizol extraction (Life Technologies, Carlsbad, CA) followed by a purification step using the GeneJET RNA Purification kit (Thermo Scientific) ...