Labshake search
Citations for Thermo Fisher :
4001 - 4050 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 5 ml (cat no. 89892) were procured from Thermo Scientific (USA). Streptavidin agarose (cat no ...
-
bioRxiv - Biochemistry 2024Quote: ... 5-(Pentafluorobenzoylamino) Fluorescein Di-β-D-Glucopyranoside (PFB-FDGlu, ThermoFisher Scientific) was used to evaluate GCase activity in live cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 uL of supernatant were subjected to DNase digest (ThermoFisher, EN0521) at 37°C for 30 minutes followed by heat inactivation at 65°C for 10 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... Cultures were maintained for 5 days in DMEM-F12 medium (Gibco) supplemented with 1% N2 (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... GlutaMAX™ (Thermo) supplemented with 5% fetal calf serum (FCS, Gibco) and 100 μg/ml penicillin-streptomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 minutes) using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) using specific primers (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 ul 10 uM TaqMan probe (5’ TTAGATCCTAGCTCACGTGTC; Applied Biosystems, #5371391), 1 ul DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 5-fold SYPRO Orange (Thermo Fisher, S6650) was added to each well ...
-
bioRxiv - Cell Biology 2023Quote: ... on a QuantStudioTM 5 real-time PCR system (Thermo Fisher Scientific). The 2- ΔCt method was used to analyze the data using GAPDH and tyrosine 3- monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with PE-coupled neutravidin (Invitrogen, 5 µg/mL) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 % FBS in neurobasal media (Gibco, Life Technologies #12348-017)) ...
-
bioRxiv - Bioengineering 2023Quote: ... and ABI Quantstudio 5 Detection System (Applied Biosystems, Carlsbad, CA,USA). the reaction volume and conditions were described in previous study (Wu et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, 41965-039) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of TaqMan Fast Virus 1-Step Master Mix (ThermoFisher), and 9 μl of molecular-grade water per reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were preloaded with 5 μM CellROX deep red reagent (Invitrogen) for 15 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Alexa 488 conjugated Claudin-5 (1:500; Invitrogen, 35-358-8), rabbit anti-CCL2 (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplification was performed using Applied Biosystems QuanStudio ®5 (Applied Biosystems). Primer sequences are shown in Supplementary Table 3.
-
bioRxiv - Microbiology 2023Quote: ... plasma was removed and 5 μg/μL Sytox Green (Molecular Probes) diluted in 200 μL sterile seawater was added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was labeled with 5 g/ml Hoechst 33342 (Molecular Probes). To detect cells with compromised plasma membrane integrity indicative of cell death ...
-
bioRxiv - Neuroscience 2022Quote: ... that were incubated for 5 min in Hoechst 33342 (Invitrogen, USA). Then ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5 % FBS in neurobasal media (Gibco, Life Technologies #12348-017)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.3 uL RNAiMax in 5 uL OptiMEM (Gibco, Thermo Fisher Scientific). The cells were seeded into 96-well cell culture plates containing culture medium with DMSO or inhibitors.
-
bioRxiv - Molecular Biology 2023Quote: ... and subsequently coated with 5 μg/mL of mouse laminin (Gibco) in DPBS at 37°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 5% fetal bovine serum (FBS; Gibco/Thermo Fisher Scientific) and 80 μg of gentamycin per ml (Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 5% fetal bovine serum (FBS; Gibco/Thermo Fisher Scientific) and 80 μg of gentamycin per ml (Gibco/Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Coomassie NativePAGE 5% G-250 Sample Additive (Thermo Fisher Scientific, #BN2004) was combined to 1/4th the final protein concentration in the supernatant ...
-
bioRxiv - Cancer Biology 2023Quote: ... and supplemented with 5% horse serum (Thermo Fischer Scientific, Gibco 16050122), 20ng/mg EGF (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... and further comprised 5 µL Lipofectamine STEM transfection reagent (ThermoFisher STEM00001), 2080 ng vector plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µl Fast SYBR™ Green Master Mix (Thermo Fisher Scientific), 2 µl distilled water ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μl of SYBR Green PCR master mix (Applied Biosystems) were mixed in a 10 μl reaction with the following conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... and then blocking buffer was added (5% normal goat serum [ThermoFisher] ...
-
bioRxiv - Immunology 2023Quote: ... Primers and probes were purchased from Life Technologies (Supplemental Table 5). Target gene expression was normalized to hypoxanthine guanine phosphoribosyltransferase (Hprt ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was resuspended in 5 μL nuclease free water (Ambion #AM9937) and incubated with 1 mM dNTPs ...
-
bioRxiv - Immunology 2023Quote: ... for 5 hours in the presence of 1x monensin (Thermo Fisher). Glucose titrations were done using using glucose-free RPMI-1640 and dialyzed serum (ThermoFisher ...
-
bioRxiv - Plant Biology 2023Quote: ... Native PAGE™ 5% G-250 Sample Additive (BN2004, Invitrogen™) was added to the supernatant at a final concentration of 0.125% ...
-
bioRxiv - Cancer Biology 2023Quote: ... previously coated with 5 μg fibronectin (Life Technologies 428 33016-015). Cells were transiently transfected with 100 ng of empty vector ...
-
bioRxiv - Systems Biology 2023Quote: ... AGC 5×104) and recorded using Xcalibur 4.3 (Thermo Fisher Scientific). The raw files were searched using Proteome Discoverer v.2.4 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 and 37°C in DMEM (Thermo Fisher Scientific #10567022) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 μg glycogen (Invitrogen Cat No. 10814010; 20 μg/μl) was added to the RNA solution after chloroform extraction to aid precipitation of the RNA ...
-
bioRxiv - Microbiology 2023Quote: ... Tf-A647 (5 μg/ml, Thermo Fisher Scientific, cat. no. T23366) and CTB-A647 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by digestion in Collagenase IV (Life Technologies; 5 mg/ml), DNase I (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Tilt series were recorded using Tomography 5 software (Thermo Fisher Scientific) with a nominal magnification of 42k and a physical pixel size of 2.18 Å/pixel ...
-
bioRxiv - Cell Biology 2023Quote: Primary hepatocytes pooled from ‘5-Donor’ human hepatocytes (Thermo Fisher Scientific) were thawed and cultured in William’s E medium supplemented with primary hepatocyte supplements (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl of a 300 µM intermediate concentration of DAPI (Invitrogen by Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... myotubes were incubated with 5 µM MitoSOX™ Red (Molecular Probes) for 20 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 µl proteinase K (20 mg/mL, Thermo Fisher 25530049) were added and samples were incubated at 65°C for 30min ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was precipitated (5 min, RT) with 1 µL glycogen (Invitrogen), 20 µL 5 M NaCl and an equal volume of isopropanol and centrifuged (14000 rpm ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were detached by 5 min treatment with Stempro Accutase (Gibco) and isolated by centrifugation ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were detached by 5 min treatment with Stempro Accutase (Gibco) and isolated by centrifugation ...