Labshake search
Citations for Thermo Fisher :
3951 - 4000 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 0.1% Tween-20 (ThermoFisher Scientific, cat. no. 9005-64-5), 0.1% IGEPAL CA-630 (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... containing 5% Protein Free Hybridoma Medium (PFHM II; ThermoFisher Scientific). On day 0 ...
-
bioRxiv - Neuroscience 2024Quote: ... in a QuantStudio 5 real-time PCR system (Applied Biosystems) using the fast run mode settings ...
-
bioRxiv - Molecular Biology 2024Quote: ... and reaction was quenched by adding 5% hydroxylamine (Acros Organics) for 15 min ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR generated amplicon libraries were obtained from 100 ng faecal DNA using the ITS1 primer set containing an overhang for the Illumina Nextera platform [forward] 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTTGGTCATTTAGAGGAAGTAA and [reverse] 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCGTTCTTCATCGATGC primers and Phusion High Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA). A duplicate reaction in 20 μl was performed with following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... in HPLC grade H2O) on a trapping column (Acclaim PepMap μ-precolumn, C18, 300 μm × 5 mm, 5 μm, 100 Ǻ, Thermo Scientific, Bremen, Germany). After sample loading ...
-
bioRxiv - Microbiology 2021Quote: ... membrane pellets were gently resuspended in 6 ml of resuspension buffer (25% [wt/wt] sucrose, 5 mM Tris, 30 mM MgCl2, 1 tablet of Pierce Protease Inhibitor Mini Tablets, EDTA-Free [Thermo Scientific], 5 U Benzonase [Novagen]), suspensions were incubated with gentle mixing for 30 min at room temperature to degrade DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR reactions were carried out in 10 µL volumes using 5 ng of total template using PowerUp Syber Green Master) in a QuantStudio 5 Real-Time PCR System Mix (Applied Biosystems, Foster City, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Immunology 2020Quote: ... Samples were injected on to a μ-Precolumn™ Cartridge (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm ID x 5 mm from Thermo Fisher Scientific) and peptides resolved on an 360 μm OD x 100 μm ID fused silica tip packed with 12cm of Aeris Peptide 3.6 μm XB-C18 100Å material (Phenomenex ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Biochemistry 2023Quote: ... and blotted for 5 s with a blot force of 5 at ∼90% humidity and 8°C using a Vitrobot Mark IV (Thermo Fisher Scientific Inc., Waltham, USA) that was placed inside an anaerobic COY tent ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Genomics 2019Quote: ... Two-colour FISH was performed by labelling 100 ng for each BAC clones with alexa fluorochromes (ChromaTide® Alexa Fluor® 488-5-dUTP, Molecular probes; ChromaTide® Alexa Fluor® 568-5-dUTP, Molecular Probes) by random priming using the Bioprim Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 x 10 ^5 TC32 or A673 cells (mixed in a 1:1 solution of growth factor reduced Geltrex [Life Technologies, catalog number A1413202] with PBS) were injected into the mouse in a peritibial location.
-
bioRxiv - Microbiology 2020Quote: DRAQ5™ Fluorescent Probe Solution 5 mM (Thermo scientific, catalog # 62251).
-
bioRxiv - Biophysics 2021Quote: ... and 5 μg SmBiT-Gγ using Lipofectamine 3000 transfection reagent (Invitrogen). After 24 h ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stained with Hoechst 33342 (5 µM; Thermo Scientific #62249) for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... mixed with 5 mM EDTA and 10 mM HEPES (Fisher Scientific) and incubated at 37.5°C with agitation for 20 mins ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% CO2 in Essential 8 medium (Cat. # A1517001, Thermo Fisher Scientific) and passaged every 3 – 4 days using Versene (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... mESCs were transfected with 5 µg plasmid using Lipofectamine 2000 (Invitrogen) and puromycin selected (1 µg/ml) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were then dissociated by 5 min incubation in TrypLE (Gibco) and gentle trituration with a pipet ...
-
bioRxiv - Developmental Biology 2021Quote: ... with QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific). The total reaction volume was 20 µl with 5 µl of 1:5 diluted RT reaction ...
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 5% (v/v) horse serum (PN:16050-122, Invitrogen), 100 μg/ml penicillin ...
-
bioRxiv - Microbiology 2019Quote: ... cells were supplemented with 5 μg/ml Propidium iodide (PI; Invitrogen). For timecourse assays ...
-
bioRxiv - Plant Biology 2020Quote: ... and 5 μL of SYBR Green PCR Master Mix (Life Technologies) in 10 μL total volume ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked with 5% heat-inactivated goat serum (Thermo Fisher Scientific) for at least 15 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were incubated for 5 min with Hoechst (1:10000; Invitrogen) to visualize the nuclei and mounted with Mowiol (Calbiochem).
-
bioRxiv - Cancer Biology 2022Quote: ... that pre-incubated for 5 min in 750 μL OptiMEM (Gibco). The mixture of plasmid-transfection reagent-OptiMEM was further incubated for 25 min before adding dropwise to lenti-X cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.1% BSA) loaded with 5 μM coelenterazine h (Thermo Fisher Scientific) for 4 h to reconstitute the holo-enzyme aequorin ...
-
bioRxiv - Neuroscience 2021Quote: ... 5% glycerol) with 1% Halt protein/phosphatase inhibitor (ThermoFisher Scientific; 78446). Samples were spun at 17,100xg for 15 minutes at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... we injected Fast-DiI (5 mg/ml in ethanol; Thermo Fisher) into the area of the cell bodies in the dorsal spinal cord ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was performed using the QuantStudio 5 cycler (Applied Biosystems, 50°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 200 V for 5 min in MOPS running buffer (Invitrogen) to concentrate the sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a Quant Studio 5 real-time PCR machine (Applied Biosystems). Expression of each gene was normalised to an internal control (GAPDH) ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-fluoro-deoxy-uridine (FDU) and nerve growth factor (NGF) (Invitrogen). Half of the media volume was exchanged every 5 days until cells were collected for analysis.
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μL of undiluted anti-V5 antibody (Thermo Fisher R960-25), 5 μl of undiluted anti-H4 antibody (Sigma 05-858) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... discoideum clones on SM/5 plates (2 g glucose (Fisher Scientific), 2 g Bacto Peptone (Oxoid) ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL T4 DNA ligase (5 Weiss U/µL, Thermo Scientific) was added followed by incubation for 1 h at room temperature ...
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... followed by staining with DAPI (5 μg/ml, D21490, Molecular Probes) for 5 min and mounting with Vectashield mounting solution (H-1000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... This was followed by addition of 5 ml TRIzol reagent (Invitrogen), 1ml chloroform and centrifugation at 13,000Xg for 15 min ...
-
bioRxiv - Biophysics 2019Quote: ... The dye Tetramethylrhodamine-5-maleimide was purchased from Invitrogen (CA, USA). All other chemicals used for this study were obtained in the highest grade available.
-
bioRxiv - Neuroscience 2019Quote: ... and probed using antibodies against tau (Tau-5, Thermo Fisher Scientific) or antibody specific to Serine 396 of tau (Phospho-Tau S396 ...