Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... ELISA was performed using IFN gamma Human Uncoated ELISA Kit (Thermo Fisher Scientific, Massachusetts, USA). For assessing cytotoxicity 5 × 103 RPMI 8226 cells expressing luciferase-GFP were co-cultured with the different effector T cells at several effector ...
-
bioRxiv - Neuroscience 2022Quote: ... The ELISA procedure was performed as described by the ELISA kit manufacturer (Invitrogen, Camarillo, CA).
-
bioRxiv - Microbiology 2023Quote: ... IL-5 and IL-13 concentration were assessed following manufacturer’s instructions using mouse uncoated IL-5 and IL-13 ELISA kits (Invitrogen).
-
bioRxiv - Immunology 2023Quote: ... IL-5 and IL-13 concentration were assessed following manufacturer’s instructions using mouse uncoated IL-5 and IL-13 ELISA kits (Invitrogen).
-
bioRxiv - Biochemistry 2020Quote: ... The ELISA was developed using 3,5,3′,5′-tetramethylbenzidine (TMB, Thermo Scientific) solution and the reaction was stopped after 10 min incubation using 0.16M Sulfuric acid ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Immunology 2020Quote: ... IL-1β ELISA kit (Catalog # 88-7013-22) and TNFα ELISA kit (Catalog # 88-7324-88) were from Invitrogen (America). LDH Cytotoxicity Assay Kit (C00170 ...
-
bioRxiv - Immunology 2022Quote: Invitrogen Uncoated ELISA kits for IFNγ (Thermo Fisher) were used following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and IL-1β Mouse ELISA Kits (ThermoFisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and IL-1β mouse ELISA kit (ThermoFisher Scientific), following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... ELISA kits were from eBioscience (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... and IFN-γ Human Uncoated ELISA Kit (Invitrogen), respectively ...
-
bioRxiv - Immunology 2022Quote: ... ELISA kits were from eBioscience (Thermo Fisher Scientific). Flow cytometry antibodies were from eBioscience ...
-
bioRxiv - Immunology 2020Quote: ... IgE Elisa Kit was purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2021Quote: The proBNP/NPPB human sandwich ELISA kit (Invitrogen) was used to determine the level of secreted human proBNP ...
-
bioRxiv - Immunology 2020Quote: ELISA kits used were all from Life Technologies: IL-8 (88-8086-88) ...
-
bioRxiv - Immunology 2021Quote: ... ELISA kits were from eBioscience (Thermo Fisher Scientific) and R&D Systems ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse IL1β ELISA kits were purchased from ThermoFisher Scientific (Cat# 88-7013-22) ...
-
bioRxiv - Neuroscience 2023Quote: ... and IL-1RA Human ELISA Kit (ThermoFisher, KAC1181). Protein concentrations were calculated per manufacturer’s instructions in pg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... and IL-1RA Mouse ELISA Kit (Invitrogen, #EMIL1RN). Calculated protein concentrations were then normalized to starting tissue weight to generate values in pg/mg.
-
bioRxiv - Neuroscience 2023Quote: ... Mouse IL1β ELISA Kit (Thermo Fisher Scientific, BMS6002), Mouse IL10 ELISA Kit (R&D Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... or IL-17A ELISA kit (Invitrogen #88-7371) according to the manufacturers recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... and TNF-α Canine ELISA Kit (# ECTNF, Invitrogen) were used to measure IL-8 and TNF-α ...
-
bioRxiv - Microbiology 2024Quote: ... The IL-8 Canine ELISA Kit (#ECCXCL8, Invitrogen) and TNF-α Canine ELISA Kit (# ECTNF ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Immunology 2023Quote: ... as well as between stratified patient plasma samples (n=7) over three time points using an IL-23 Human ELISA Kit (BMS2023-3, ThermoFisher, Canada), as per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Determination of sIL-6R was performed in the FN of NL and 21 dpi of aged WT and GFAP-IL6Tg (n=3-6/experimental group) using a precoated mouse ELISA kit (EMIL6RA, Fisher Scientific) and following the manufacturer’s instructions ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and (MtWOX5) 5’-CACCATGCAGACGGTCCGAGATCTGTC-3’ and 5’- CCTTCGCTTAAGTTTCATGTAA-3’ (AhWOX5) and cloned into pENTR-dTOPO (Invitrogen). The entry clones of AhWOX5 & MtWOX5 recombined through LR clonase Gateway technology (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... the PCR products obtained with 2 primers (AV48_SMCHD1_gPCR_F: 5’-AGGAGCGCGTTTGAATCGG-3’, AV47_SMCHD1_gPCR_R 5’-CTTCGCGTACCTGACACACAC-3’) were TOPO-cloned (Thermo Fisher, #450071) and sent for sequencing.
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... This was followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for about 10 min ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Neuroscience 2021Quote: ... tau proteins were measured with Tau-5 antibodies using ELISA according to manufacturer’s instructions (The Human Tau Solid-phase sandwich ELISA, #KHB0041, Thermo Scientific).
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... 5’-AAAGCTCGAGCTCTACAAATGTGGTATGGCTG-3’ (Thermo Fisher Scientific). PCR products were purified (Monarch PCR Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5’-UAGCGACUAAACACAUCAA-3’ (Thermo Fisher Scientific); RNF168 siRNA #1,siGENOME Smartpool Dharmacon (Cat# M-007152-03) ...
-
bioRxiv - Physiology 2020Quote: ... 5’-UUGAUUUGCUGAGAAGGAC-3’ (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Immunology 2021Quote: ... CCL5 concentration in the tumor lysates was analyzed by ELISA (Mouse RANTES Uncoated ELISA Kit Invitrogen) and normalized to the determined total protein concentrations.
-
bioRxiv - Developmental Biology 2022Quote: ... ELISA was performed using the ultrasensitive Amyloid beta ELISA kit from Invitrogen (Paina et al.,2011KHB3544) per manufacturer’s instructions with media samples diluted 1:2 in standard diluent buffer ...
-
bioRxiv - Immunology 2019Quote: ... Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ELISA was performed on total and SEC fractions using Tau (Total) Human ELISA Kit (KHB0041, Invitrogen) by following the directions provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ELISA for Apolipoprotein B100 (ApoB100) was done using the ApoB100 ELISA KIT (Thermo Scientific, Waltham, MA) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ELISAs were carried out using Ig Isotyping Mouse Uncoated ELISA Kit (Invitrogen, Cat# 88-50630-88), according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... interleukin-6 and -8 (IL-6 and IL-8) human Instant Elisa™ kits and matrix metalloproteinase-1 (MMP-1) human Elisa kit from ThermoFisher Scientific.
-
bioRxiv - Cancer Biology 2022Quote: ... TNF alpha mouse high sensitivity ELISA kit and IL-6 mouse high sensitivity ELISA kit were from Invitrogen (Thermo Fisher Scientific), mouse CCL2/JE/MCP-1 quantikine ELISA kit ...