Labshake search
Citations for Thermo Fisher :
351 - 400 of 3895 citations for PDGF Receptor Substrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Grids prepared without substrate or with DT substrate were loaded into a Titan Krios G4 electron microscope (Thermo Scientific) operated at 300 kV for automated data collection using SerialEM 73 ...
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Biophysics 2021Quote: ... western blots were performed to normalize for receptor quantity using monoclonal anti-HA antibody (Thermo Scientific). Reactions were started by adding 150μL partially purified receptor samples to 300μL of reaction mixture and incubating on ice for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... Membranes were probed with antibodies against: estrogen receptor β (Erβ, rabbit, 1:1000, Invitrogen PA1-311), tumor necrosis factor receptor 1 (TNFR1 ...
-
bioRxiv - Immunology 2023Quote: ... After treating the cells for 15 minutes (min) with Fc Receptor Binding Inhibitor Polyclonal Antibody (ThermoFisher), they were stained for 30 min at 4°C in the dark and washed twice again ...
-
bioRxiv - Evolutionary Biology 2023Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transiently transfected with receptor constructs using LipofectamineTM 2000 transfection system (ThermoFisher, cat# 11668019). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... cells were first incubated with an anti-CD16/CD32 Monoclonal Antibody to block FC receptors (Invitrogen). Cells were washed using PBS and incubated with LIVE/DEAD™ dye for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... and IGF-1 receptor (Catalog number: AM51331, siRNA ID:110754) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen), according to manufacturer’s established protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Signals were visualized on X-ray film with a commercial substrate (SuperSignal West Dura Extended Duration Substrate; Thermo Fisher Scientific) and quantified using ImageJ software.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Proteins were visualized by chemiluminescent detection (Image Quant) of peroxidase substrate activity (SuperSignal West Femto Maximum Sensitivity Substrate, Thermo Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Nitrocellulose membranes were developed with SuperSignal West Pico Chemiluminescent Substrate or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Protein bands were developed on Medical X-Ray Blue Films (AGFA) using PierceTM ECL Plus Western Blotting Substrate or SuperSignal WestFemto Maximum Sensitivity Substrate (ThermoFisher) and quantified in Image-J software ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated for 5 min at room temperature with chemiluminesent HRP substrate (SuperSignal West Dura Extended Duration Substrate, Thermo Fisher).
-
bioRxiv - Developmental Biology 2023Quote: ... After extensive TBST washing membranes were imaged using WESTARNOVA2.0 chemiluminescent substrate (Cyanagen) or SuperSignal West Femto Maximum Sensitivity Substrate (34095; Thermo Fisher) and ChemiDoc MP Imaging system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Thermo Fisher Scientific) was used for signal development.
-
bioRxiv - Microbiology 2020Quote: ... and Ultra-TMB substrate (ThermoFisher, Grand Island, NY). All binding steps were carried out at 37°C for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... and Femto chemiluminescent substrate (Thermo Fisher Scientific, www.thermofisher.com).
-
bioRxiv - Plant Biology 2019Quote: ... using SuperSignal West Pico chemiluminescent substrate (ThermoFisher Scientific) and documented with a CCD-camera (ChemiDoc ...
-
bioRxiv - Microbiology 2019Quote: ... Membrane was developed using SuperSignal substrate (Thermofisher Scientific).
-
bioRxiv - Immunology 2022Quote: ... 1-Step Ultra TMB substrate (Thermo Fisher Scientific) was added for 5 min and plates were analyzed using a plate reader (BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... Blots were visualized with chemiluminescent substrate (Thermo Scientific) using a ChemiDoc imaging system ...
-
bioRxiv - Neuroscience 2021Quote: ... and then visualized with Pico Plus substrate (ThermoFisher) and a ChemiDoc MP System ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were developed using SuperSignal WestFemto substrate (ThermoFisher).
-
bioRxiv - Immunology 2021Quote: ... ECL Western blot substrate was bought from Thermofisher Scientific.
-
bioRxiv - Microbiology 2019Quote: ... SuperSignal West Femto Maximum Sensitivity substrate (Thermo Fisher) was applied for gO detection according to the manufacturer’s instructions and Pierce ECL Western Blotting Substrate (Thermo Fisher ...
-
bioRxiv - Synthetic Biology 2019Quote: ... or HRP substrate (Thermo Fisher Scientific, Waltham, USA).
-
bioRxiv - Genomics 2020Quote: ... SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher # 34578) or Femto Maximum Sensitivity Substrate (Thermo # 34095 ...
-
bioRxiv - Biophysics 2022Quote: ... Bound phage were detected with TMB substrate (ThermoFisher) following a 30 minutes incubation with horseradish peroxidase-conjugated anti-M13 monoclonal antibody (GE Healthcare) ...
-
bioRxiv - Bioengineering 2020Quote: ... 125 nM RNaseAlert substrate v2 (Thermo Fisher Scientific), 1× cleavage buffer (CB ...
-
bioRxiv - Cell Biology 2021Quote: ... Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) was added to membranes to visualize proteins by chemiluminescence using X-ray film or a Chemidoc station (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... ECL HRP substrate (SuperSignal™ West Pico, ThermoFisher) was added to detect protein targets by chemiluminescence ...
-
bioRxiv - Microbiology 2020Quote: ... developed using Pierce ECL Western Blotting Substrate (ThermoFisher), and exposed to film.
-
bioRxiv - Synthetic Biology 2021Quote: ... Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) or SuperSignal West Femto chemiluminescent Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific #34078) or ProSignal Dura (Prometheus #20-301 ...
-
bioRxiv - Plant Biology 2021Quote: ... Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... SuperSignal West Pico Chemiluminescent substrate (Thermo Fisher Scientific) was used to visualize protein bands with Amersham Hyperfilm (GE).
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of TMB substrate (Thermo Scientific). Readings were taken at OD650 using a BioTek reader with a program set for kinetic ELISAs where readings were taken every minute for a total of 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μL of substrate (Catalog# 34028, Thermo Fisher) was added to each well following 4 washes with PBST and incubated at 37 °C for 20 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... Clarity ECL Western blotting substrate (Thermo Fisher Scientific) was used for visualization of the chemiluminescent signals in a ECL ChemoCam Imager (Intas ...
-
bioRxiv - Molecular Biology 2022Quote: ... Supersignal West Femto enhanced chemiluminescence substrate (Thermo Scientific) was used and blots imaged using the chemiluminescence imaging analyzer (LAS3000mini ...
-
bioRxiv - Biochemistry 2022Quote: Super Signal West Pico Chemiluminescent Substrate (Thermo Scientific) was used to develop chemiluminscence and imaged using Kodak Medical X-ray Films ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pierce ECL Plus Western Blotting Substrate (Thermo Scientific) was applied to membranes ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with the CCF4-AM substrate (Life Technologies), and incubated overnight at 11 °C ...