Labshake search
Citations for Thermo Fisher :
351 - 400 of 4028 citations for Influenza Virus Hemagglutinin HA H7N9 Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and anti-HA (26183, Invitrogen), followed by secondary Alexa Fluor 488 anti-mouse HRP antibody (A28175 ...
-
bioRxiv - Microbiology 2020Quote: ... Desalted peptides were labeled with Tandem Mass Tags (TMT) using TMTPro-16plex isobaric tags (ThermoFisher Scientific; #A44520) as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant AtCSD1 protein containing a 6xHis-tag was purified using Dynabeads His-Tag (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
Variation of wine preference amongst consumers is influenced by the composition of salivary proteinsbioRxiv - Biochemistry 2023Quote: Tandem mass tag (TMT) labelling was performed using the TMT10plexTM Mass Tag Labelling Kit (Thermo Fisher Scientific) with minor modifications from the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The eluate for SFB-HA-UbSPRTN was then immunoprecipitated with anti-HA-beads (ThermoFisher Scientific) and eluted with 2 mg/ml HA peptide (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... HA-p75K349A or HA-p75R384A plasmids using Neon™ transfection system (Thermo scientific, Cat: MPK10025) prior to plating ...
-
bioRxiv - Plant Biology 2021Quote: ... HA-tagged NPH3 was immunoprecipitated using Pierce™ Anti-HA Magnetic Beads (Thermo Fisher Scientific). Thiophosphorylation was visualised by immunoblotting with anti-thiophosphoester monoclonal antibody (clone 51-8 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... One round of anti-HA MACS was done using anti-HA magnetic beads (Thermo Fisher). Then ...
-
bioRxiv - Neuroscience 2024Quote: ... Kir2.1-T2A-Rpl10a-HA and mutKir2.1-T2A-Rpl10a-HA inserts were constructed by GeneArt (Invitrogen) and subcloned into an hSyn-DIO backbone.
-
bioRxiv - Microbiology 2020Quote: Viral RNA was isolated from the influenza A positive clinical samples using the MagMax Viral RNA isolation reagent (Thermo Fisher) on an Eppendorf epMotion 5073 liquid handling workstation ...
-
bioRxiv - Microbiology 2021Quote: ... and viral cDNA was generated using the universal F(A) influenza primer (GTTACGCGCCAGCAAAAGCAGG) and the Maxima Reverse Transcriptase (Thermo Scientific). RNA Copy Number was quantitatively determined by Droplet Digital qPCR (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... Extracted vRNA was reverse transcribed using a 1:1 ratio of universal influenza primers (53)(S2 Table) and Maxima RT (Thermofisher) per protocol instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were next treated with 1: 1000 dilution of primary antibody (6-His tag mouse anti-tag, Invitrogen) for 1 hr at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies) using the oligos forward (BamHI ...
-
bioRxiv - Cell Biology 2024Quote: ... Myc-tag immunoprecipitation (IP) was carried out using the Myc-tag magnetic IP kit (Thermo Fisher Scientific, 88844), following the manufacturer’s recommended protocol.
-
bioRxiv - Cell Biology 2021Quote: ... media was collected from each well at 24 h and virus RNA was isolated using MagMAX Virus/Pathogen II Nucleic Acid Isolation Kit (Thermo Fisher Scientific) and automated extraction was carried out using KingFisher™ Flex Purification System ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phasi Charoen like virus and Culex Y virus) were maintained at 28 °C in Leibovitz’s L-15 medium (Invitrogen: catalogue number: 21083027) supplemented with 10% foetal bovine serum (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic RNAs of PRRSV (porcine reproductive and respiratory syndrome virus) and CSFV (classic swine fever virus) were extracted following the TRIzol method (TRIzol reagent, Invitrogen, California, USA). Extracted RNA of PRRSV was examined using VDx PRRSv qRT-PCR (NA/EU dual ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid was detected by virus-specific primer/probe according to indicated reference sequences (Table 1) utilizing TaqMan™ Fast Virus 1-Step Master Mix (Applied Biosystems) and QuantStudio™ 5 (ThermoScientific ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-S-tag (Thermo Scientific, #MA1-981), anti-TMEM43 (Abcam ...
-
bioRxiv - Microbiology 2019Quote: ... we used Dynabeads™ His-Tag (Invitrogen) for Ni-affinity purification ...
-
bioRxiv - Bioengineering 2022Quote: 6x-His tag antibodies (Invitrogen, MA1-21315) were coated at 2 µg/mL in PBS onto 96-well half- area high binding plates (Corning ...
-
bioRxiv - Biochemistry 2020Quote: ... mouse anti-V5-Tag (46-0705, Invitrogen), mouse anti-Myc-Tag (9B11 ...
-
bioRxiv - Neuroscience 2020Quote: ... tag from pcDNA3.1-nV5-DEST vector (Invitrogen). To generate AP2M1 or LRRK2 single or multiple mutants ...
-
bioRxiv - Microbiology 2022Quote: ... anti-FLAG tag (Thermo Fisher (PA1-984B)).
-
bioRxiv - Microbiology 2021Quote: ... or DYKDDDDK Tag Monoclonal Antibody (FG4R) (Invitrogen) (1 ...
-
bioRxiv - Biochemistry 2021Quote: ... and V5-tag (R96025) from Life Technologies.
-
bioRxiv - Cell Biology 2019Quote: ... mouse Flag-Tag monclonal antibody(Thermo Fisher, WB 1:1000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... anti-KDDDDK Tag antibody (Invitrogen, MA1-91878), Monoclonal antibody anti-GAPDH produced in mouse (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: ... 6x-His Tag antibody is from ThermoFisher Scientific (MA1-21315-D550) ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-His Tag (Invitrogen MA1-21315). Secondary antibody used are ...
-
bioRxiv - Immunology 2021Quote: ... AccuPrime Tag DNA polymerase High Fidelity (Invitrogen) with initial denaturation at 94 °C for 2 min ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-His tag (ThermoFisher Scientific, MA1-21315), and anti-tubulin (DHSB ...
-
bioRxiv - Cell Biology 2022Quote: ... V5-tag antibody (Cat # R960-25, Invitrogen), GST antibody (Cat# 2622S ...
-
bioRxiv - Microbiology 2023Quote: ... or anti S-tag (MA1981, Life Technologies). Proteins were detected using horseradish peroxidase (HRP)-conjugated goat anti-rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... V5 tag (R960-25, from Thermo Fisher), Nrf1 (this specific antibody made in our own laboratory [40]) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-V5 tag (Invitrogen, catalog no.R960-25).
-
bioRxiv - Microbiology 2024Quote: ... and anti-Xpress tag antibody R91025 (Invitrogen). Anti-PGK1 antibody 22C5D8 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-Strep-tag II (NC9261069, Thermo Fisher), anti-FLAG epitope tag (L00018 ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies include: anti-V5 Tag (Invitrogen, ref R96025 ...
-
bioRxiv - Genetics 2024Quote: ... The FISH Tag DNA Multicolor Kit (Invitrogen) was used for nick translation and chemical labelling with Alexafluor (AF ...
-
bioRxiv - Biophysics 2020Quote: ... 20% fetal calf serum (FCS) (Invitrogen), 0.1 mM non-essential amino acids ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% FCS (Life Technologies) and kept on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... both supplemented with 10% FCS (Invitrogen), 2 mM glutamine (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% FCS and HEPES 15mM (Gibco). For inhibitor/activator treatments samples were dissected at E11.5 or E11.75 ...
-
bioRxiv - Neuroscience 2020Quote: ... After addition of 20% FCS (Invitrogen), the tissue was mechanically dissociated and filtered through a 35µm nylon strainer (Falcon) ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 10% FCS (Gibco®). Cells (2.5×104/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 10% FCS (Gibco®) and 1% penicillin/streptomycin (Gibco® ...
-
bioRxiv - Bioengineering 2021Quote: ... supplemented with 10% FCS (Gibco #10437028) and 50U/mL penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10 % dialyzed FCS (Gibco), 201.3 μM Met (63-68-3 ...