Labshake search
Citations for Thermo Fisher :
351 - 400 of 6643 citations for IL 22 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Fetal brains were evaluated by Western blot (corticotropin releasing factor receptor 1 [CRFR1]; glucocorticoid receptor [GR], interleukin [IL]-6 receptor [IL-6R]; IL-17A and β-actin, Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Molecular Biology 2021Quote: HT-22 cells were cultured in Dulbeccos’s modified Eagle medium (DMEM, Invitrogen, Karlsruhe, Germany) supplemented with 10 % heat-inactivated fetal calf serum ...
-
bioRxiv - Neuroscience 2021Quote: ... NPR-22 cDNA was cloned into the pcDNA3.1 TOPO expression vector (Thermo Fisher Scientific). Receptor activation was studied in Chinese hamster ovary cells (CHO ...
-
bioRxiv - Neuroscience 2019Quote: The following dyes were used for confirmatory purposes: LysoTracker Blue DND-22 (#L7525, ThermoFisher), MitoTracker Deep Red FM (#M22426 ...
-
bioRxiv - Neuroscience 2020Quote: ... brains were mounted on superfrost plus microscope slides (#22-037-246, Thermo Fisher Scientific) and stored at −80 degrees Celsius ...
-
bioRxiv - Biophysics 2020Quote: ... consisting of 22 μM NSP5 supplemented with 6.4 μM Alexa647 dye (carboxylic acid, ThermoFisher) or 8 μM His-tagged NSP2 labelled with 8 μM Atto488-nitrilotriacetic acid (NTA ...
-
bioRxiv - Microbiology 2022Quote: ... Total IgG levels were assayed according to manufacturer’s instructions (Thermofisher; Cat # 88-50400- 22). Viral-specific IgG93 were quantified by coating a 96-well plate with whole A/California/04/2009 (H1N1 ...
-
bioRxiv - Microbiology 2021Quote: ... 22 µl of the eluent underwent reverse transcriptase (RT) treatment (Superscript IV, Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Enzyme-linked immunosorbent assay to detect I□-10 (Thermo Fisher Scientific-88-7105-22) cytokine was performed according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... The 22 SCX fractions of DSSO were analyzed using an Ultimate3000 (Thermo Fisher Scientific) connected to a 50-cm analytical column packed with C18 beads (Dr Maisch Reprosil C18 ...
-
bioRxiv - Microbiology 2022Quote: ... were grown for four days at 22°C using SF-900 SMF media (Gibco) substituted with 5% FBS and 1% antibiotic/antimycotic ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and MCF7 cells (ATCC, HTB-22) were cultured in RPMI 1640 medium (Life Technologies) at 37°C in a 5% CO2 humidified incubator ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments were carried out at room temperature (20 – 22 °C) using HBSS (Invitrogen, 14025092). At the beginning of imaging experiments ...
-
bioRxiv - Molecular Biology 2023Quote: MCF7 (HTB-22) were grown in RPMI supplemented with 10% (vol/vol) FBS (GIBCO), glutamine ...
-
bioRxiv - Immunology 2023Quote: ... Five-micron tissue sections were collected onto Plus slides (Fisher Scientific #22-042-924), air-dried ...
-
bioRxiv - Neuroscience 2024Quote: ... were mounted on Superfrost Plus Microscope slides (#22-037-246, Fisher Scientific, Hampton, NH) and processed for immunohistochemistry according to standard protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by periodic acid–Schiff (Cat. No. 22-110-645, Fisher Scientific, Hampton, NH) post-staining without hematoxylin counterstaining was performed and analyzed as previously described (27) ...
-
bioRxiv - Cancer Biology 2024Quote: Tissues were fixed overnight in 10% neutral buffered formalin (Fisher Scientific #22-050-105), embedded in paraffin ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cultured in RPMI with 5 % heat inactivated human serum (HS) and 2 ng/mL interleukin (IL)-6 (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). In vitro experiments with KJON cells were performed with 2 % HS in RPMI and IL-6 (1 ng/mL) ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Immunology 2022Quote: ... either alone or with anti-IL-1β or anti-IL-6 neutralizing antibodies (Thermofisher, Waltham, MA), and ensuing protein lysates blotted for phosphorylated STAT-3 (pSTAT3) ...
-
bioRxiv - Immunology 2021Quote: ... UltraComp eBeads™ and mouse IL-5/IL-13 ELISA kits were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... Murine IL-2 ELISA’s were performed using the mouse IL-2 ELISA kit (Thermo Fisher Scientific).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasma IL-6 levels were measured by mouse IL-6 ELISA kit (ThermoFisher Scientific, Waltham, MA).
-
bioRxiv - Immunology 2020Quote: ... IL-2 was measured from culture supernatants using a mouse IL-2 ELISA kit (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... and IL-12 levels were determined using the IL-12 p70 Mouse Uncoated ELISA Kit (Invitrogen). Isolated tumors were snap-frozen on dry ice ...
-
bioRxiv - Microbiology 2023Quote: ... IFN-γ IL-4 and IL-6 were measured by Mouse Uncoated ELISA Kit (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), and forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL-23p19-AF488 (fc23cpg, Invitrogen); anti-IL-1β-APC (NJTEN3 ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-6 (20 ng/mL, ThermoFisher). To generate human induced pluripotent stem cells (iPSCs) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100ng/ml IL-4 (Gibco, USA) for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... caveolin-2 (Thermo Fisher, Rockford, IL), and STIM1/CRACR2A (CRAC regulator 2A ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse IL-1β (Invitrogen, # 701304); anti-mouse Cleaved IL-1β (Cell Signaling Technology ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylbenzidine (ThermoFisher Scientific, Rockford, IL, USA) and read at 450 nm according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Systems Biology 2022Quote: ... and IL-8 (Invitrogen, catalog # KHC0081) levels in the media samples were conducted according to the manufacturer’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in duplicate by ThermoFisher (Life Technologies Corporation, Chicago, IL 60693) using Z’Lyte (76) ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-8 (ThermoFisher Scientific, catalog # PHC0884), and ChaCha (Anaspec ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-10 (ThermoFisher Scientific, Waltham, MA), and IL-1β (R&D Systems ...
-
bioRxiv - Immunology 2021Quote: ... IL-4 (Invitrogen, #12-7041-41) and Foxp3 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... and anti-IL-2 APC (Invitrogen) in permeabilization buffer for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... TRIzol reagent (Thermo Scientific, Rockford, IL) was used to extract the total RNA from pepper and N ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-6 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... anti-mouse IL-2 (ThermoFisher, USA), Alexa Fluor® 594 conjugate secondary antibody (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-IL-1β antibody (Invitrogen), mouse anti-MCP-1 antibody (Abcam) ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 (100 ng/ml, Invitrogen), TNF-α (10 ng/ml ...