Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 7 Fluoro 3 oxo 3 4 dihydroquinoxaline 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: Cells were loaded with 3 μM Fura-2 AM (Invitrogen/ThermoFisher) (Kd at RT = 225 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... from 2-3 µg of RNA using oligo(dT) (Invitrogen 18418012) as primer ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were washed 3 times with 2 mL DPBS (Gibco), scraped and lysed in 4% SDC buffer (4% sodium deoxycholate ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 µL of tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) to 30 µL of sample ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were passaged every 2-3 days using Accutase (Thermo Fisher). For experiments about 5000 cells were seeded per dish ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were rinsed with 2-3 ml of PBS (Gibco, #10010023) and treated with 0,5 mL ReLeSR (Stemcell technologies ...
-
bioRxiv - Biophysics 2023Quote: ... 3 µL of 2% 0.2 µm carboxylated FluoSpheres (Invitrogen, Carlsbad, CA), 20 µL of 20 mM Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP ...
-
bioRxiv - Immunology 2023Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Thermo Fisher) assay was performed by incubating the cells with 50 µg/µl MTT (5 mg/ml stock ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were loaded with 3 µM of Fura-2 AM (Invitrogen) in extracellular solution (ECS ...
-
bioRxiv - Physiology 2020Quote: ... muscles were stained for 3 minutes with 10μM 4-(4-diethylaminostyrl)-N-methylpyridinium iodide (4-Di-2ASP, Molecular Probes) to allow imaging muscle with an upright epifluorescence microscope (Leica DMR ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Peptides were first loaded for 3 min onto the Acclaim PepMap 100 C18 trap column (75 µm x 2 cm, 3 µm material, Thermo Scientific) with 5 µL min-1 of 3.2% (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed 2-3 times (200 rpm, 5 min at 4°C) in eBioscience™ Permeabilization buffer (250 µl/well) (Invitrogen) and resuspended in eBioscience™ Fixation/Permeabilization solution (Invitrogen ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: HeLa cell pellets (∼2×107) or MCF7 cell pellets (∼4×107) were lysed with 3 mL Mammalian Protein Extraction Reagent (Thermo Scientific), supplemented with 2X HALT protease inhibitor (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... 2 and 4 h post dosing on day 3 and collected on ice in microcentrifuge tubes containing K2-EDTA (Fisher Scientific). Within 30 min after collection ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3-4 mg total protein and 2 ug of KIF1C antibody or 10 ug mCherry antibody (Invitrogen mCherry Monoclonal Antibody (16D7)) were used ...
-
The effects of caloric restriction on adipose tissue and metabolic health are sex- and age-dependentbioRxiv - Physiology 2023Quote: ... Tissues in formalin were fixed at 4°C for 2-3 days before being washed and stored in DPBS (Life Technologies). Tissues on dry ice were stored at −80°C prior to downstream analysis.
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Developmental Biology 2022Quote: ... Table 2) incubated for 3 overnights at 4 °C in blocking buffer with Alexa-dye conjugated secondary antibodies (1:500, Molecular Probes) incubated for 1 overnight at 4 °C in blocking buffer ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cancer Biology 2023Quote: Cyclic RGD conjugated MPIO were prepared using 1 μm diameter Dynabead MyOne carboxylic acid MPIO (65011, Fisher Scientific, UK). MPIO were washed in MES buffer and resuspended ...
-
bioRxiv - Biochemistry 2024Quote: ... and G3BP1 were labeled on their N-termini with AF488 (Alexa Fluor 488 carboxylic acid succinimidyl ester, Thermo Fisher). Storage buffer was exchanged to Labeling buffer (50 mM MES pH 6.5 ...
-
bioRxiv - Immunology 2021Quote: ... and then stained with cell impermeable SYTOX green nucleic acid stain (3 µM, ThermoFisher Scientific) for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were then acidified with 3 drops of 37% hydrochloric acid (Acros Organics, USA) and analyzed ...
-
bioRxiv - Genetics 2022Quote: ... TO-PRO-3 Iodide carbocyanine monomer nucleic acid stain (1:1000, Thermo Fisher, cat# T3605) was used to stain DNA ...
-
bioRxiv - Cancer Biology 2023Quote: DYPM was determined using Bis-(1,3-dibutylbarbituric acid)trimethine oxonol (Dibac4(3)) (Thermo Fisher Scientific). Cells were cultivated on 30 mm glass coverslips ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then resuspended in 10 µM CellEvent Caspase 3/7 activity reporter in PBS (Invitrogen, #C10723) and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were passaged every 3-7 days as single cells using TrypLE™ Select CTS™ (Gibco). The ROCK inhibitor Y27632 (Fujifilm ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of effector caspase activity 20 µM CellEvent Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific) was added to the infected cells prior to imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Taqman® assays (Supplementary table 3) and QuantStudio™ 7 Flex Real Time PCR system (ThermoFisher, USA), and relative expression levels determined using QuantStudio™ 7 Real Time PCR software.
-
bioRxiv - Neuroscience 2019Quote: ... unc-7 rescue plasmids were made using the Multisite Gateway® 3-Fragment Vector Construction Kit (Invitrogen). A 1078bp mec-4 promoter fragment (as previously used ...
-
bioRxiv - Cell Biology 2021Quote: ... MEF cells were supplemented with CellEvent™ Caspase-3/7 green detection reagent (Life Technologies, Darmstadt, Germany) following manufacturer’s instructions before aldehyde fixation ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 microliters of the apoptosis detection reagent (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermofisher, C10723) was added to each well and the slide returned to the incubator for another 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were blotted at 100% humidity for 3 s (13°C, 0 s drain time, blot force -3 to +2) with a Vitrobot Mark IV (Thermo Fisher Scientific) and plunged into liquid ethane ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mM of 4-(2-hydroxyethyl)-1-piperazine-1-ethanesulfonic acid (HEPES) (Gibco) and 1 ng/mL of human bFGF (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mmol/l 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco, Germany #15630056), 2.5 ng/ml human fibroblast growth factor-basic (hFGF2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% human serum (Valley Biomedical) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 10% human serum (Valley Biomedical ...
-
bioRxiv - Cell Biology 2022Quote: ... and 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (Invitrogen, Life Technologies, Grand Island, NY) supplemented with 5% human serum (Valley Biomedical) ...