Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6H Imidazo 4 5 1 ij quinolin 6 one 4 5 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 10 μl RNA was mixed with 4 μl 5 x RT buffer (Invitrogen, Breda, The Netherlands), 0.2 μl RNAsin (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 5 min incubation with 500 µL DPBS plus 4 µM Hoechst 33342 (Life Technologies). Images were acquired using an Eclipse Ti2-E epifluorescence microscope (Nikon ...
-
bioRxiv - Immunology 2021Quote: ... for 20 min at 4°C or with 5 ng/mL of BODIPY 500/510 (Invitrogen). Cells were washed with PBS and immediately analyzed.
-
bioRxiv - Plant Biology 2021Quote: ... 0.3-5 µg of total RNA was treated with 4 U of TURBO DNase (Life Technologies) in 2 consecutive incubation steps ...
-
bioRxiv - Microbiology 2020Quote: ... pA1* cells were treated with 500µM of the protonophore TCS (3,3’,4’,5-Tetrachlorosalicylanilide; Fisher scientific). The fluorescent signal from at least 100,000 individual bacteria per condition was measured by flow cytometry with a MCSQuant® VYB analyzer (Miltenyi Biotec ...
-
bioRxiv - Neuroscience 2022Quote: ... Running conditions used were 4–12% Bis-Tris gel in 5% MOPS Running Buffer (Invitrogen, NP0001) at 200 V for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was isolated from liver tissues (n=4-5 mice/group) using Trizol (ThermoFisher Scientific). Concentration was measured by nanodrop (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were incubated for 5 min at 65°C and 4 ml 5x FSB buffer (Invitrogen), 1 ml murine RNase inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 5 min at 37 °C with 4 ml pre-warmed TrypLE 1X Express (Gibco), pipetted off the cell culture dish ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 5 min at 37 °C with 4 ml pre-warmed TrypLE 1X Express (Gibco), quenched with pre-warmed growth medium ...
-
bioRxiv - Cell Biology 2021Quote: ... and boiled for 5 minutes before fractionating on a 4–12% NuPAGE Bis-Tris gel (Invitrogen). Proteins on a gel were transferred to a nitrocellulose membrane and analyzed by using the antibodies at 1:3000-10,000 dilutions ...
-
bioRxiv - Cell Biology 2022Quote: ... and centrifuged at 1000 rpm for 5 min at 4°C (accuSpin Micro 17R; Fisher Scientific). The proteins were extracted in 50 mM Tris buffer (pH 7.8 ...
-
bioRxiv - Immunology 2022Quote: ... 4×104 sorted peritoneal and thymic macrophages were stained with 5 µM eFluor 450 (Thermo Fisher) in PBS for 10 min at 37℃ ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with L-glutamine (4 mM) and 5% foetal bovine serum (Thermo Scientific, Waltham, MA, USA). Cell culture medium was supplemented with 0.1 mM NaI and 1 mM NaBr (to model physiological availability of iodine and bromide) ...
-
bioRxiv - Microbiology 2023Quote: ... and boiled for 5 min before separation on a 4-12% NuPAGE Bis-Tris gel (Invitrogen) for immunoblotting.
-
bioRxiv - Developmental Biology 2022Quote: RNA was isolated from 4-5 pairs of ovaries with TRIzol reagent (Invitrogen Catalogue No. 15596026) and cDNA was synthesized from 1µg of RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Stage 4 hippocampal neurons (5–10 DIV) were transfected with Lipofectamine 2000 (Thermo Fisher, Cat# 11668019). The following expression times were used ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 µl of each sample was loaded to NativePAGE 4 to 16% bis-tris gels (Invitrogen). Proteins were transferred to PVDF membranes with NuPAGE Transfer Buffer (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... washed 4 x 5 min in PBST and mounted with ProLong Gold Antifade Mountant (Invitrogen, #P36935) under coverslips (VWR ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were passaged every 4–5 d with UltraPure 0.5 mM EDTA (Thermo Fisher Scientific, 15575020). For the generation of 3D neural organoids ...
-
bioRxiv - Biochemistry 2023Quote: ... Each well was loaded with 100 µL of a 5 µM Fluo-4 AM (Molecular Probes) solution in imaging buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2023Quote: ... we incubated 5-7 μg of BACMID DNA with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 250 μL of Opti-MEM serum free media for 30 minutes at 23ºC ...
-
bioRxiv - Cell Biology 2023Quote: ... and boiled for 5 minutes before fractionating on a 4–12% NuPAGE Bis-Tris gel (Invitrogen) and transferred to nitrocellulose membrane ...
-
bioRxiv - Immunology 2023Quote: ... pre-coated (5 μg cm−2) 4-well chamber slide (Thermo Fisher Scientific, cat. no. 154526). A fluorescence image was captured using an LSM 880 confocal microscope (Carl Zeiss AG ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µg/ml gentamycin sulfate) supplemented with 4 to 5 µg/ml ConA (Thermo Scientific AAJ61221MC). To determine the effects of type I interferons ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cells were passaged every 4-5 days using 0.5 mM EDTA (Life Technologies, #15575-020) to dissociate cells maintaining clumps ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: GL261 cells (4 × 107/mL) were incubated with 5 μM CFSE solution (Invitrogen Molecular Probes, USA) diluted in PBS for 15 min at 37 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: GL261 cells (4 × 107/mL) were incubated with 5 μM CFSE solution (Invitrogen Molecular Probes, USA) diluted in PBS for 15 min at 37 °C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were blocked in PBS-T containing 5% NDS and then incubated overnight at 4°C with rabbit anti-PSD95 (1:1000, Invitrogen/ThermoFisher) and guinea pig anti-vGlut2 (1:10,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Developmental Biology 2022Quote: ... centrifuged for 3 min at 300g at 4°C and resuspended in 1 ml pre-warmed enzymatic mix of 5 mg/ml Dispase (Gibco, 17105041) and 0.5 mg/ml Liberase TH Research Grade (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556, Thermo Fisher Scientific, 1:500) or Alexa Fluor680 (A31556 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cortical neurons were pelleted at 2,500 x g for 5 minutes at 4 °C and resuspended in 1 mL Neurobasal outgrowth media (Thermo Scientific, 21103049), supplemented with B-27 (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... at 1:100 overnight at 4°C in 5% BSA in the presence of 0.05% sodium azide (BP922I-500; Thermo Fisher Scientific), 0.5% Triton X-100 (161-0407 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... in 5% FBS overnight at 4°C and Alexa Fluor® 488 goat anti-mouse IgG secondary antibody (1:200; #10696113, ThermoFisher) for one hour at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated in secondary antibody solution for 4 hours at RT (5% normal goat serum in PBST, Alexa Fluor 633 anti-guinea pig 1:200 (Thermo Scientific)) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 and 5 we confined cells by using a soft acrylamide gel and either 1% Low Melting Agarose (Invitrogen, 16520-100) or a second soft acrylamide gel ...
-
bioRxiv - Bioengineering 2022Quote: ... 4-Chlorobenzenesulfonate Salt (DID) and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Carlsbad, CA, USA). Ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2022Quote: ... and blotted for 4 to 6 seconds at 4°C and 100% humidity using the Vitrobot system (ThermoFisher), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were washed 4 times with PBST and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Genomics 2024Quote: ... for 6h using lipofectamine 3000 (Invitrogen). Knockdown was confirmed by RT-qPCR at 24-72h post-transfection.
-
bioRxiv - Plant Biology 2019Quote: ... pollinated stigma was incubated in FM™ 4-64 Dye (N-3-Triethylammoniumpropyl-4-6-4-Diethylamino Phenyl Hexatrienyl Pyridinium Dibromide, Life Technologies T3166, 8.23 μM) for five minutes and subsequently washed in 1/2 Murashige and Skoog basal medium containing 10 % (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... one primer was 5’ phosphorylated using a T4 Polynucleotide Kinase (ThermoFisher) using recommended reaction conditions ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... dihydro-chloride (DAPI) (Invitrogen. Cat. Nº: D3571) at 0.5 µg/µl ...