Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 FLUOROQUINOLINE 2 3 DICARBOXYLIC ACID DIETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, Eugene, OR, USA). Quantification of GFAP ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Systems Biology 2022Quote: ... 6-Diamidino-2-phenylindole (DAPI) staining Hoechst (Invitrogen 33342) was used and added to the secondary antibody staining solution at a dilution of 1:500 ...
-
bioRxiv - Genomics 2019Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) at a final concentration of 3 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...
-
bioRxiv - Zoology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI, Invitrogen, Carlsbad, CA, USA) in dd H2O for 20 min ...
-
bioRxiv - Physiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:25000, Thermo Fisher) diluted in PBS and mounted with Prolong Gold Antifade Medium (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride; Life Technologies) was used to counterstain cell nuclei ...
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (#P36931, Thermo Fisher Scientific) for nuclei counterstaing ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). Whole-mount stained slices were then washed in PBS and incubated overnight in RapiClear 1.52 ...
-
bioRxiv - Bioengineering 2022Quote: ... LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, D3571) 1:1000 in 1% BSA included in the second wash ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Genomics 2023Quote: ... and 10 mM HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid, Gibco 15630080), and incubated at 37°C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Synthetic Biology 2020Quote: Cell growth and multiplication was assessed by Fluorescence Assorted Cell Sorting and fluorescence microscopy with 6-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, Life Technologies, USA) as a probe ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Ag83 parasite growth and multiplication were assessed by Fluorescence Assorted Cell Sorting and fluorescence microscopy with 6-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, Life Technologies, USA) as a probe ...
-
bioRxiv - Biophysics 2022Quote: ... EVs were stained with 5-(and-6)-Carboxyfluorescein diacetate succinimidyl ester (CFDA-SE, hereinafter referred as CFSE) (Thermo Fisher, Catalog No. C1157) and separated as described previously [10] ...
-
bioRxiv - Immunology 2021Quote: ... The aqueous droplets were then pooled and broken on ice using water-saturated diethyl ether (Fisher Scientific). Beads were re-emulsified in an overlap extension RT-PCR mixture using the SuperScript III RT-PCR Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... ethyl ester (TMRE) (Thermo Fisher #T669) at a final concentration of 0.3 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... or Alexa647 NHS ester (ThermoFisher, A20006) for 15 minutes at RT ...
-
bioRxiv - Immunology 2021Quote: ... acetyl ester (CM-H2DCFDA) probe (Invitrogen) for 45 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... carboxyfluorescein succinimidyl ester (Thermo Fisher Scientific) at 37°C for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: BODIPY TMR-X NHS Ester (ThermoFisher) was used to fluorescently label LRRK2RCKW and LRRK1RCKW ...
-
bioRxiv - Cell Biology 2019Quote: ... or rhodamine NHS ester (ThermoFisher, 46406). NHS esters and probes were incubated overnight in 0.1M sodium bicarbonate solution (pH 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... succinimidyl ester (AcX, Thermo Fisher Scientific) in PBS overnight ...