Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI Thermo Fisher Scientific) and AlexaFluor 555 anti-mouse (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and 300 µM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sections were counterstained with DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; Invitrogen; D1306) and cover-slipped with Fluoromount-G (Southern Biotech ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated with 4’,6-diamidino-2-phenylindole (DAPI, 62247, ThermoFisher Scientific) for 2 minutes at 1:2000 dilution in 1X PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 6% Tris-glycine or NuPAGE 4-12% Bis-Tris gels (Invitrogen; cat# NP0321BOX) and transferred to Immobilon-P PVDF membranes (Millipore Sigma ...
-
bioRxiv - Genetics 2023Quote: ... For each 6-well added 2 mL of 4% PFA (cat#28906 Thermofisher) in PBS (cat#10010-023 Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300 μM of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) was used to stain cell nuclei.
-
bioRxiv - Microbiology 2023Quote: ... fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) diluted 1:1000 in phosphate-buffered Saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, 62248). The percentage of infected cells at each time point was quantified using ImageJ software.
-
bioRxiv - Molecular Biology 2023Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei were stained with DAPI (4’,6-diamino- 2-phenylindole, dihydrochloride, Thermofisher, #D3571) solution (0.5 mg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... 4 and 6 hpi RNA was extracted from cells using TRIzol (Invitrogen; 15596026). RNA was isolated and precipitated following the manufacturer’s institutions and 200ng was reverse transcribed into cDNA using the ABI cDNA synthesis kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). The preparations were analyzed under a confocal microscope Zeiss 510 LSM META and Zeiss 780-NLO (Carl Zeiss Microscopy ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... All sections were counterstained with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher) before mounting.
-
bioRxiv - Cell Biology 2024Quote: ... Cell nuclei were labeled with dapi (4 ’, 6-diamidino-2-phenylindole, Invitrogen, P36931). Images were obtained in the Zeiss LSM 800 Confocal Optical Microscope at Centro de Micro y Nanoscopía de Córdoba (CEMINCO-CONICET-UNC ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... No mycoplasma were detected in cultures by 4′,6-diamidino-2-phenylindole or TO-PRO-3 (Thermo Fisher Scientific) staining.
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... 4-Chlorobenzenesulfonate Salt (DID) and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Carlsbad, CA, USA). Ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2022Quote: ... and blotted for 4 to 6 seconds at 4°C and 100% humidity using the Vitrobot system (ThermoFisher), before plunging immediately into liquid ethane for vitrification ...
-
bioRxiv - Bioengineering 2023Quote: ... The cells were washed 4 times with PBST and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 5-6 pieces per well were cultured in a 6-well culture plate (Fisher Scientific). For up to two weeks tissue pieces were cultured in Advanced Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2022Quote: ... per well were distributed in Ibidi® µ-slide 8-well chambered coverslips and stained with 0.8 μM of the membrane specific fluorescent styryl dye N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64; Thermo Fisher Scientific, Waltham, MA, USA) in the presence of 0 μM (control) ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Cancer Biology 2022Quote: ... and ran on QuantStudioTM 6 Flex Real-Time PCR System using QuantStudioTM 6 and 7 Flex Real-Time PCR software v1.0 (Applied Biosystems). Relative gene expression levels were quantified using β-actin or human TBP as housekeeping genes ...
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Orange 5-(and-6)-(((4-chloromethyl)benzoyl)amino)tetramethyl-rhodamine CMTMR (Molecular Probes, C2927) was used to label iNeuron cells ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated 5 minutes with at room temperature with 500 ng/ml 4’,6-Diamidino-2-Phenylindole Dilactate (DAPI; ThermoFisher) in DPBS and mounted in ProLong®Gold (ThermoScientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 3 wells of a 6-well plate of mESC (corresponding to 6*10^6 cells approximately) were resuspended in 1 mL Trizol (Invitrogen,15596018) vortexed two times for 30 seconds and incubated 5 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...
-
bioRxiv - Biochemistry 2020Quote: ... 500 mM 6-aminohexanoic acid) was added to lysates right before loading samples into a NativePAGE Bis-Tris gel 4-16% (Life Technologies). The proteins were separated according to Wittig et al.32 and transferred onto a PVDF membrane using a standard Tris-glycine transfer buffer with 0.05% SDS ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... and Nuclear DNA was counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher). Alternatively ...
-
bioRxiv - Biophysics 2021Quote: ... Membranes were stained with 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluenesulfonate (TMA-DPH; Molecular Probes) at a final concentration of 100 μM and the cells were then immobilized on a 2% agarose pad made with sporulation buffer covered with a no.1.5 coverslip ...
-
bioRxiv - Biophysics 2020Quote: ... Nuclei were detected by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, ThermoFisher Scientific, USA) for 10 minutes at RT ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatants were aspirated and pellets were resuspended in 3-5 µL of 1X PBS containing 0.02 mM 1-(4-(trimethylamino) phenyl)-6-phenylhexa-1,3,5-triene (TMA-DPH)(Invitrogen).Cells were mounted on glass slides with polylysine-treated coverslips ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...