Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6' ETHYL SPIRO 1 3 DIOXANE 2 3' INDOLIN 2' ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the nucleus with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, 1:200), microtubules with an anti-tubulin antibody produced in mouse (1:200 ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:5000; Invitrogen; Carlsbad, CA, USA) allowed visualization of cell nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µL of 1 mg/mL DAPI (4′,6-diamidino-2-phenylindole; ThermoFisher Scientific) was added to each sample and incubated at RT in darkness for a further 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... The 5’ and 3’ fragments (2 μg of each) were ligated for 1 h at 16°C by T4 DNA ligase (Invitrogen) and purified by phenol-chloroform extraction ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... ionomycin (1 μg/ml) and monensin (2 μg/ml) for 3-4 hours at 37°C in complete IMDM medium (Gibco). Viability staining was performed using the fixable viability dye eFluor780 ...
-
bioRxiv - Immunology 2022Quote: ... The sorted cells were then incubated with Totalseq-C antibodies (1:50 dilution) on ice for 30 min, washed 3 times (by default, top up with 2% FBS (Gibco) in DPBS (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The next day, the larvae were washed (3×, 1× PBST) and incubated for 30 minutes in 2 μg/mL Hoechst 33342 (Invitrogen) in 1× PBT at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... The dissociated cells were washed 3 times with chilled PBS containing 1% heat-inactivated FBS and 2 mM EDTA (Gibco).
-
bioRxiv - Immunology 2023Quote: ... Purified T cells were activated for 1 to 3 days with Human T-Activator anti-CD3/CD28 dynabeads at a 1:2 bead-to-cell ratio (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 2 µL streptavidin-HRP (1:5,000; Invitrogen, s911) for 1 hour at room temperature ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Cell Biology 2023Quote: ... zebrafish embryos were anesthetized in 0.02% 3-aminobenzoic acid ethyl ester (tricaine) and fixed in PBS (150mM NaCl, 10mM PO43-, pH 7.4) (Invitrogen) with 4% paraformaldehyde (PFA ...
-
bioRxiv - Biochemistry 2023Quote: ... Restriction-digested shuttle vectors -1-6 (33) and -2-1 (14) for wc-1 and wc-2 respectively were recombined with PCR (Thermo Fisher Scientific, Catalog # F549S) products amplified with primers bearing point mutations of wc-1 or wc-2 ...
-
bioRxiv - Genomics 2020Quote: ... One microliter of 2 U/μl TURBO DNase (Invitrogen) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Following one washing step in PBS+2% BSA (Gibco), cell suspensions were incubated for 20 min on ice with TotalSeq™-C anti-human Hashtag oligos (HTOs ...
-
bioRxiv - Developmental Biology 2020Quote: ... ToPro-3 (1:1000, Invitrogen). Secondary antibodies used in this study were purchased from Invitrogen and include ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Cell Biology 2021Quote: ... 1ml of bone marrow was incubated in one well of 6-well plate with 3 ml StemPro™ MSC serum-free medium (Gibco, Thermo Scientific). Media was changed after every two days until it reached to confluency ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Physiology 2020Quote: ... and incubated with 100 mM 6-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (6-NBDG) (Life Technologies) in 10 nM Tris/HEPES buffer containing 150 mM KCl or 150 mM NaCl for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
bioRxiv - Biochemistry 2021Quote: ... and/or ToPro-3-3 (1 μM; Thermo-Fisher Scientific, Waltham, MA) for 10 minutes at RT ...
-
bioRxiv - Immunology 2019Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, ThermoFisher).
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Neuroscience 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Life Technologies) staining was added to visualize nuclei.
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6- diamidino-2-phenylindole (DAPI; Invitrogen D1306) was added during the secondary antibody incubation at a concentration of 700 ng/ml ...
-
bioRxiv - Microbiology 2020Quote: ... 6 diamidino-2-phenylindole (DAPI) (ThermoFisher scientific, 10116287) and mounted with Fluoromount-G (Cambridge Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidine-2′-phenylindole dihydrochloride (Thermo Fisher Scientific) was added for nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... 2-6 mL (Thermo Scientific, catalog no. 88516), and the final protein concentration was measured via A280 absorbance.
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermofisher Scientific). The mountant was allowed to cure overnight and coverslips were analysed on an Olympus FV3000 confocal microscope.
-
bioRxiv - Pathology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, USA). Samples were visualized with a fluorescence microscope (Olympus ...
-
bioRxiv - Pathology 2021Quote: ... 4’,6-Diamidino-2-phenylindole (DAPI, D21490, ThermoFisher) stain was done for 15 min at 4°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen). Confocal analyses of stained slides were performed using a TCS SP8 Laser Scanning Spectral Confocal Microscope (LEICA Microsystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher) and ActinRed™ 555 ReadyProbes™ (Molecular Probes ...
-
bioRxiv - Microbiology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) at 37 °C for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: DAPI (4′,6-diamidino-2-phenylindole, D1306, Invitrogen) staining was performed by incubation at 1:500 for 10 min in DPBS ...