Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 5 μg/ml Hoechst 33342 and 5 µM CellRox Deep Red (Invitrogen) and/or MitoSox Red (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: - Falcon round-bottom polystyrene tubes 5 mL (Cat# 14-959-5, Fisher Scientific)
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2023Quote: ... 5-fluorocytosine (100 mg/kg/d; diluted in sterile saline; 5-FC; ThermoFisher) was used in combination with PEA (0.5 mg/kg/d ...
-
bioRxiv - Immunology 2023Quote: ... 5x10-5 M 2-mercaptoethanol (2-ME) and 5 mM HEPES (all Invitrogen).
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were washed with cold PBS followed by another centrifugation step (300 x g 5 minutes) and resuspended in 5 mL of 5 μg mL-1 of Hoechst 33342 (Thermo Fisher Scientific) diluted in warm PBS ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was subjected to 5’ adapter ligation with a 5’ chimeric DNA-RNA adapter (5’aminolinker-GTTCAGAGTTCTACAGTCCGACGATCrNrNrNrN) using RNA ligase (EL0021, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluoroorotic acid (Fisher Scientific), adenosine-5′-monophosphate disodium (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/ml blasticidin (Invitrogen) and 200 μg/ml zeocin (Invivogen ...
-
bioRxiv - Immunology 2021Quote: ... 5% penicillin-streptomycin (PenStrep, Gibco), 1x MEM non-essential amino acids solution ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5% FBS (Gibco, 16140-071) + 1% Pen-Strep (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% FCS (Gibco), 25 nM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM EDTA (ThermoFisher Scientific) at 37 °C for 20 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 µL SuperaseIN (Invitrogen) in 100 µL total volume at 37 °C for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... 5% AA (Gibco® MEM), Non-Essential Amino Acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 µg/ml fibronectin (Invitrogen) was added during overnight ligand incubation to promote cardiomyocyte attachment to the tissue culture surfaces.
-
bioRxiv - Neuroscience 2019Quote: ... containing DRAQ-5 (Thermo Fisher, 62251 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Cancer Biology 2019Quote: 5 μM MitoSOX Red (Invitrogen) was added to cells in HBSS for 30 min followed by washing ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... supplemented with 5% FBS (Gibco), 2 mM L-Glutamine (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... containing 5% FBS (Gibco, 26140079) and 10mM EDTA ...